Construct: ORF TRCN0000491704
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021117.2_s317c1
- DNA Barcode:
- AAAAATAGACCATACGTCCGGAAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- SORCS1 (114815)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491704
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_052918.5 | 99.9% | 100% | 2769C>T |
| 2 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_001206571.2 | 97.3% | 96.4% | (many diffs) |
| 3 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_001206570.2 | 96.3% | 96.2% | (many diffs) |
| 4 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_001206569.2 | 96.2% | 94.6% | (many diffs) |
| 5 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_001206572.2 | 96.2% | 94.6% | (many diffs) |
| 6 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_011539199.3 | 95.6% | 94.7% | (many diffs) |
| 7 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_017015614.2 | 95.1% | 93.1% | (many diffs) |
| 8 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | NM_001013031.3 | 94.9% | 93.5% | (many diffs) |
| 9 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_011539201.3 | 93.5% | 92.9% | (many diffs) |
| 10 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_017015615.2 | 91.5% | 89.5% | (many diffs) |
| 11 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_017015616.1 | 79.9% | 78.1% | (many diffs) |
| 12 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_017015617.1 | 79.8% | 77.8% | (many diffs) |
| 13 | human | 114815 | SORCS1 | sortilin related VPS10 doma... | XM_017015618.1 | 55.7% | 53.8% | (many diffs) |
| 14 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | NM_021377.3 | 88.1% | 93.6% | (many diffs) |
| 15 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | NM_001252501.1 | 85.2% | 89.2% | (many diffs) |
| 16 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | NM_001290356.1 | 85.2% | 90.9% | (many diffs) |
| 17 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | XM_011247308.2 | 84.8% | 88.8% | (many diffs) |
| 18 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | XM_006527244.3 | 83.8% | 88.4% | (many diffs) |
| 19 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | XM_017318265.1 | 50.5% | 53.4% | (many diffs) |
| 20 | mouse | 58178 | Sorcs1 | sortilin-related VPS10 doma... | XM_006527243.1 | 50% | 53.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 3576
- ORF length:
- 3504
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgggaaaa gttggcgccg gcggcggctc ccaagcccgg ctgagcgcgc 121 tcctcgccgg cgcggggctc ttgatcctct gcgccccggg cgtctgcggc ggcggctcct 181 gctgcccctc gccgcacccc agctccgctc cacgctcggc ctcgacccct aggggctttt 241 cccaccaggg gcggccaggc agggctcctg ccacgcccct gcccctcgta gtgcgtcccc 301 tgttctcagt ggcccccggg gaccgagcgc tatccctgga gcgggctcgg ggcactgggg 361 catccatggc ggttgctgca cgctccggcc ggaggagacg gagcggagcg gatcaggaga 421 aggcagaacg gggagagggc gcgagtcgga gcccccgggg agtgctaaga gatggagggc 481 agcaggagcc tgggactcgg gagcgggacc cggacaaagc cacccgcttc cggatggagg 541 agctgagact gaccagcacc acgtttgcgc tgacgggaga ctcagcacac aaccaagcca 601 tggtccactg gtctggccac aacagcagcg tgattctcat tttgacaaag ctctatgact 661 ataacctggg gagcatcaca gagagctcgc tttggaggtc aaccgattat ggaacaacct 721 atgagaagct gaatgataaa gttggtttga aaaccatttt gagctatctc tatgtgtgtc 781 ctaccaacaa gcgtaagata atgttactca cagacccgga gattgagagc agtttattga 841 tcagctcaga tgaaggggca acttatcaaa agtaccggct gaacttctac attcaaagct 901 tgctttttca ccccaaacaa gaagactgga ttctggcata cagtcaagac caaaagttat 961 acagctctgc tgaatttggg agaagatggc agcttatcca agaaggggtt gtaccaaaca 1021 ggttctactg gtctgtgatg gggtcaaata aagaaccaga ccttgtgcat cttgaggcca 1081 gaactgtgga tggtcattca cattatctaa cttgccgaat gcagaactgt acagaggcca 1141 acaggaatca gccttttcca ggctacattg acccagactc tttgattgtt caggatcatt 1201 atgtgtttgt tcagctgaca tcaggagggc ggccacatta ctacgtgtcc taccgaagga 1261 atgcatttgc ccaaatgaag cttccgaaat atgctttgcc caaggacatg catgttatca 1321 gcaccgatga gaatcaggtg ttcgcagcgg tccaagaatg gaaccagaat gacacgtaca 1381 acctctacat ctcagacaca cgtggtgtct acttcaccct ggccttggag aatgtccaga 1441 gcagcagagg ccctgagggc aacatcatga tcgacctcta tgaggtagca gggataaagg 1501 gaatgttctt ggctaacaag aagattgaca accaagtgaa gactttcatc acatataaca 1561 aaggcagaga ctggcgtttg ctgcaggcgc cggacacgga tctaaggggg gaccccgtgc 1621 actgcttgct gccctattgc tcactacacc ttcacctgaa ggtctctgag aatccctaca 1681 catcagggat cattgccagc aaagacacag ctccaagcat catagtggca tcaggtaata 1741 taggttctga attgtcagac actgacatca gcatgtttgt ctcttcagat gcagggaaca 1801 cctggagaca gatctttgaa gaagagcaca gtgttttgta cctggatcaa ggtggagtcc 1861 tggttgctat gaaacacaca tctctcccaa ttcgacatct ttggttgagt tttgatgaag 1921 ggagatcttg gagcaaatac agtttcacat ctattccact ttttgtggat ggggttctgg 1981 gtgagcctgg agaagagact ctcatcatga cagtgtttgg acacttcagc caccgctctg 2041 aatggcagct ggtcaaagta gattacaagt ccatttttga tagacggtgt gccgaagagg 2101 actacagacc ttggcagctg cacagccagg gggaagcatg tatcatggga gcaaaaagga 2161 tatataagaa gcgaaaatca gagcggaagt gtatgcaagg aaaatatgca ggagctatgg 2221 aatctgaacc ctgtgtctgc actgaggctg attttgattg cgactatggt tatgagcgac 2281 acagcaatgg ccagtgcctg ccggcatttt ggttcaatcc atcctctctg tcaaaggatt 2341 gcagcttggg acagagttac ctcaatagta ctgggtacag gaaggtggtt tccaataatt 2401 gcactgatgg cgtaagggaa cagtacactg ccaaaccgca gaagtgccca gggaaagccc 2461 cgcgggggct gcggatagtc acggctgatg gaaagctgac agcggaacaa ggacacaacg 2521 tcactctcat ggtgcaatta gaagagggtg atgttcagcg gacactcatc caagtggact 2581 ttggcgatgg tatcgcggtg tcttacgtca atctcagctc catggaagat gggatcaaac 2641 acgtctatca gaacgtgggc attttccgtg tgaccgtgca ggtggacaac agtctgggtt 2701 ctgacagcgc cgtcctgtac ttacatgtaa cttgtccctt ggagcacgtg cacctgtctc 2761 ttccctttgt caccacaaag aacaaagagg tcaatgcgac ggcagtgctg tggcccagcc 2821 aagtgggcac cctcacttat gtgtggtggt acggaaacaa cacggagcct ttgatcacct 2881 tggagggaag catatccttc agatttactt cagaaggaat gaataccatc acagtgcagg 2941 tctcagctgg gaatgccatc ctacaagaca caaagaccat cgcagtatat gaggaattcc 3001 ggtctcttcg cttgtccttt tctccaaacc tggatgacta caacccggac atccctgagt 3061 ggaggaggga catcggtcga gtcatcaaaa aatccctggt ggaagccaca ggggttccag 3121 gccagcacat cctggtggcg gtgctccctg gcttacccac cactgctgaa ctctttgtcc 3181 taccctatca ggatccagct ggagaaaaca aaaggtcaac tgatgacctg gagcagatat 3241 cagaattgct gatccacacg ctcaaccaaa actcagtaca cttcgagctg aagccaggag 3301 tccgagtcct tgtccatgct gctcacttaa cagcggcccc cctggtggac ctcactccaa 3361 cccacagtgg atctgccatg ctgatgctgc tctcagtggt gtttgtgggg ctggcagtgt 3421 tcGTCATCTA CAAGTTTAAA AGGAGAGTAG CTTTACCCTC CCCTCCCTCC CCTTCTACTC 3481 AACCTGGTGA CTCATCTCTC CGATTGCAAA GAGCAAGACA CGCCACTCCG CCTTCAACGC 3541 CAAAGCGGGG ATCTGCTGGG GCACAGTATG CAATTTAAGA CCCAGCTTTC TTGTACAAAG 3601 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 3661 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 3721 ACGAAAAAAT AGACCATACG TCCGGAATAC GCGTTAAGTC gacaatcaac ctctggatta 3781 caaaatttgt gaaagatt