Transcript: Human NM_001252678.1

Homo sapiens Bardet-Biedl syndrome 4 (BBS4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
BBS4 (585)
Length:
2468
CDS:
519..1562

Additional Resources:

NCBI RefSeq record:
NM_001252678.1
NBCI Gene record:
BBS4 (585)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001252678.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006724 GCATTGATATTTCGCCTAGAA pLKO.1 217 5UTR 100% 4.950 6.930 N BBS4 n/a
2 TRCN0000006723 CCTGGATAAGTGTAACCCTTT pLKO.1 1100 CDS 100% 4.050 5.670 N BBS4 n/a
3 TRCN0000006725 GCACCCTTCGATTGGAAGATT pLKO.1 900 CDS 100% 5.625 7.313 N BBS4 n/a
4 TRCN0000417110 ACCTAGGAGTTTGCTACATAT pLKO_005 421 5UTR 100% 13.200 10.560 N BBS4 n/a
5 TRCN0000250504 CTGGATAAGTGTAACCCTTTA pLKO_005 1101 CDS 100% 10.800 8.640 N Bbs4 n/a
6 TRCN0000418255 GCACGATCTGACTTATATAAT pLKO_005 500 5UTR 100% 15.000 10.500 N BBS4 n/a
7 TRCN0000429274 TAGTCCTCAGAGTGCTGATAA pLKO_005 285 5UTR 100% 13.200 9.240 N BBS4 n/a
8 TRCN0000418763 TGACCAATCTGGAAGATATAG pLKO_005 1045 CDS 100% 13.200 9.240 N BBS4 n/a
9 TRCN0000006722 CCTCAGGTTGTGAGGTTTATT pLKO.1 1988 3UTR 100% 1.500 1.050 N BBS4 n/a
10 TRCN0000006726 GCTGTTATCAAAGAACAGCTT pLKO.1 154 5UTR 100% 0.264 0.185 N BBS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252678.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05878 pDONR223 100% 66.6% 66.2% None (many diffs) n/a
2 ccsbBroad304_05878 pLX_304 0% 66.6% 66.2% V5 (many diffs) n/a
3 TRCN0000468273 GAGCCCACTTCAGATTCCTACTGT pLX_317 28% 66.6% 66.2% V5 (many diffs) n/a
Download CSV