Transcript: Mouse NM_001253689.1

Mus musculus inner membrane protein, mitochondrial (Immt), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Immt (76614)
Length:
2514
CDS:
152..1564

Additional Resources:

NCBI RefSeq record:
NM_001253689.1
NBCI Gene record:
Immt (76614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125630 CCCGTTTCTATGCTGTTCAAA pLKO.1 1783 3UTR 100% 5.625 7.875 N Immt n/a
2 TRCN0000323849 CCCGTTTCTATGCTGTTCAAA pLKO_005 1783 3UTR 100% 5.625 7.875 N Immt n/a
3 TRCN0000125629 CCGTCCTTACACTGCTATCAT pLKO.1 2309 3UTR 100% 5.625 7.875 N Immt n/a
4 TRCN0000323848 CCGTCCTTACACTGCTATCAT pLKO_005 2309 3UTR 100% 5.625 7.875 N Immt n/a
5 TRCN0000125631 GCTGGCAAACTCTCTACTGAT pLKO.1 1091 CDS 100% 4.950 6.930 N Immt n/a
6 TRCN0000353890 GCTGGCAAACTCTCTACTGAT pLKO_005 1091 CDS 100% 4.950 6.930 N Immt n/a
7 TRCN0000125633 GCCTGTACCAATACTTCCTTT pLKO.1 1846 3UTR 100% 4.950 3.960 N Immt n/a
8 TRCN0000323918 GCCTGTACCAATACTTCCTTT pLKO_005 1846 3UTR 100% 4.950 3.960 N Immt n/a
9 TRCN0000125632 GCACACTCCAACATACTGAAA pLKO.1 665 CDS 100% 4.950 3.465 N Immt n/a
10 TRCN0000323847 GCACACTCCAACATACTGAAA pLKO_005 665 CDS 100% 4.950 3.465 N Immt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253689.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07719 pDONR223 100% 54.6% 55% None (many diffs) n/a
2 ccsbBroad304_07719 pLX_304 0% 54.6% 55% V5 (many diffs) n/a
3 TRCN0000470375 CCTGTACGACGGTCTCAATCCCGC pLX_317 21.6% 54.6% 55% V5 (many diffs) n/a
Download CSV