Transcript: Mouse NM_001253784.1

Mus musculus differentially expressed in FDCP 8 (Def8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Def8 (23854)
Length:
3873
CDS:
158..1540

Additional Resources:

NCBI RefSeq record:
NM_001253784.1
NBCI Gene record:
Def8 (23854)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105902 CGTTAAACAGACCTGCGATAA pLKO.1 628 CDS 100% 10.800 15.120 N Def8 n/a
2 TRCN0000354203 CGTTAAACAGACCTGCGATAA pLKO_005 628 CDS 100% 10.800 15.120 N Def8 n/a
3 TRCN0000105904 AGCGTTAAACAGACCTGCGAT pLKO.1 626 CDS 100% 2.640 3.696 N Def8 n/a
4 TRCN0000105900 CGCTTCCTCTTTGGCGTTAAA pLKO.1 3069 3UTR 100% 13.200 9.240 N Def8 n/a
5 TRCN0000354131 CGCTTCCTCTTTGGCGTTAAA pLKO_005 3069 3UTR 100% 13.200 9.240 N Def8 n/a
6 TRCN0000105903 CGAAGAATGCAAACAGGTGAT pLKO.1 451 CDS 100% 4.050 2.835 N Def8 n/a
7 TRCN0000332181 CGAAGAATGCAAACAGGTGAT pLKO_005 451 CDS 100% 4.050 2.835 N Def8 n/a
8 TRCN0000105901 GCCATACTTCATCACCTGCAA pLKO.1 1135 CDS 100% 2.640 1.848 N Def8 n/a
9 TRCN0000332255 GCCATACTTCATCACCTGCAA pLKO_005 1135 CDS 100% 2.640 1.848 N Def8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03468 pDONR223 100% 36.3% 32.5% None (many diffs) n/a
2 ccsbBroad304_03468 pLX_304 0% 36.3% 32.5% V5 (many diffs) n/a
3 TRCN0000471991 CACGAACCGTACTAAAGGATGGAT pLX_317 59.7% 36.3% 32.5% V5 (many diffs) n/a
Download CSV