Transcript: Mouse NM_001253834.1

Mus musculus ATPase, Ca++-sequestering (Atp2c1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Atp2c1 (235574)
Length:
4774
CDS:
304..3060

Additional Resources:

NCBI RefSeq record:
NM_001253834.1
NBCI Gene record:
Atp2c1 (235574)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101426 CCTGCGGACTTACGCTTATTT pLKO.1 811 CDS 100% 15.000 21.000 N Atp2c1 n/a
2 TRCN0000335049 CCTGCGGACTTACGCTTATTT pLKO_005 811 CDS 100% 15.000 21.000 N Atp2c1 n/a
3 TRCN0000043278 GCACGAGTATAGCAGCATTAA pLKO.1 2423 CDS 100% 13.200 18.480 N ATP2C1 n/a
4 TRCN0000043281 CGTCAGTATCACTGTGGCAAT pLKO.1 612 CDS 100% 4.050 5.670 N ATP2C1 n/a
5 TRCN0000375113 ATGGGCAAGTACTGAATTAAA pLKO_005 3304 3UTR 100% 15.000 10.500 N Atp2c1 n/a
6 TRCN0000375112 GTCTGTCTTAGATGGATATAA pLKO_005 3389 3UTR 100% 15.000 10.500 N Atp2c1 n/a
7 TRCN0000375111 CAGTGAAGATGAACCATTATG pLKO_005 498 CDS 100% 13.200 9.240 N Atp2c1 n/a
8 TRCN0000101428 CAAACCATCATGTCTGCAATA pLKO.1 2347 CDS 100% 10.800 7.560 N Atp2c1 n/a
9 TRCN0000043280 GCTGCTGTAATGTGATTTGTT pLKO.1 1325 CDS 100% 5.625 3.938 N ATP2C1 n/a
10 TRCN0000307640 GCTGCTGTAATGTGATTTGTT pLKO_005 1325 CDS 100% 5.625 3.938 N ATP2C1 n/a
11 TRCN0000043282 CCAGTGGATAAAGATGTCATT pLKO.1 2557 CDS 100% 4.950 3.465 N ATP2C1 n/a
12 TRCN0000310147 CCAGTGGATAAAGATGTCATT pLKO_005 2557 CDS 100% 4.950 3.465 N ATP2C1 n/a
13 TRCN0000101427 GCCAGTGGATAAAGATGTCAT pLKO.1 2556 CDS 100% 4.950 3.465 N Atp2c1 n/a
14 TRCN0000101425 GCTTTCTTACTAACACACAAA pLKO.1 3454 3UTR 100% 4.950 3.465 N Atp2c1 n/a
15 TRCN0000101429 CCTTTCACAGATAGTGCCAAA pLKO.1 2118 CDS 100% 4.050 2.835 N Atp2c1 n/a
16 TRCN0000348404 GCTTATGAGCAGGTGATTAAG pLKO_005 1744 CDS 100% 13.200 7.920 N Atp2c1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14114 pDONR223 100% 88% 93% None (many diffs) n/a
Download CSV