Transcript: Human NM_001253835.1

Homo sapiens insulin like growth factor binding protein 7 (IGFBP7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
IGFBP7 (3490)
Length:
1051
CDS:
35..874

Additional Resources:

NCBI RefSeq record:
NM_001253835.1
NBCI Gene record:
IGFBP7 (3490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001253835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222701 GTCACTATGGAGTTCAAAGGA pLKO.1 630 CDS 100% 3.000 4.200 N IGFBP7 n/a
2 TRCN0000077944 GCTGGTATCTCCTCTAAGTAA pLKO.1 733 CDS 100% 5.625 4.500 N IGFBP7 n/a
3 TRCN0000080109 CCTCATCTGGAACAAGGTAAA pLKO.1 604 CDS 100% 10.800 7.560 N Igfbp7 n/a
4 TRCN0000414696 AGCTGTGAGGTCATCGGAATC pLKO_005 572 CDS 100% 6.000 4.200 N IGFBP7 n/a
5 TRCN0000077946 ACAGTGGTTGATGCCTTACAT pLKO.1 824 CDS 100% 5.625 3.938 N IGFBP7 n/a
6 TRCN0000077945 GTAAGGAAGATGCTGGAGAAT pLKO.1 750 CDS 100% 4.950 3.465 N IGFBP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253835.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00840 pDONR223 100% 98.1% 98.2% None 832_835delACACinsG;837_838insGGTGCCGAGCTA n/a
2 ccsbBroad304_00840 pLX_304 0% 98.1% 98.2% V5 832_835delACACinsG;837_838insGGTGCCGAGCTA n/a
3 TRCN0000477428 GTTTCAAAAAATCTAATCGCTTCG pLX_317 38.4% 98.1% 98.2% V5 832_835delACACinsG;837_838insGGTGCCGAGCTA n/a
Download CSV