Transcript: Human NM_001254738.1

Homo sapiens Rho family GTPase 3 (RND3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
RND3 (390)
Length:
2807
CDS:
279..1013

Additional Resources:

NCBI RefSeq record:
NM_001254738.1
NBCI Gene record:
RND3 (390)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001254738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330304 CGGACAGATGTTAGTACATTA pLKO_005 696 CDS 100% 13.200 18.480 N RND3 n/a
2 TRCN0000047714 GCGGACAGATGTTAGTACATT pLKO.1 695 CDS 100% 5.625 7.875 N RND3 n/a
3 TRCN0000353657 AGATTGGAGCAGCTACTTATA pLKO_005 781 CDS 100% 13.200 10.560 N RND3 n/a
4 TRCN0000047715 CGACACACAAAGAATAGAGTT pLKO.1 476 CDS 100% 4.950 3.960 N RND3 n/a
5 TRCN0000330303 ATCCTAATCAGAACGTGAAAT pLKO_005 328 CDS 100% 13.200 9.240 N RND3 n/a
6 TRCN0000330234 TCTAGAGGATGTGATCTAATT pLKO_005 1484 3UTR 100% 13.200 9.240 N RND3 n/a
7 TRCN0000330305 GAGAGCCACAAAGCGGATTTC pLKO_005 911 CDS 100% 10.800 7.560 N RND3 n/a
8 TRCN0000077332 CAGAACGTGAAATGCAAGATA pLKO.1 336 CDS 100% 5.625 3.938 N Rnd3 n/a
9 TRCN0000301364 CAGAACGTGAAATGCAAGATA pLKO_005 336 CDS 100% 5.625 3.938 N Rnd3 n/a
10 TRCN0000047716 GATCCTAATCAGAACGTGAAA pLKO.1 327 CDS 100% 4.950 3.465 N RND3 n/a
11 TRCN0000047717 GCTCAGCTTTACAGTCGGAAA pLKO.1 808 CDS 100% 4.050 2.835 N RND3 n/a
12 TRCN0000047713 CCAAACAGATTGGAGCAGCTA pLKO.1 775 CDS 100% 2.640 1.848 N RND3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001254738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00102 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00102 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468061 AGATCTGAGCACTTGCCCAGGTAG pLX_317 61.7% 100% 100% V5 n/a
Download CSV