Transcript: Human NM_001256054.2

Homo sapiens C9orf72-SMCR8 complex subunit (C9orf72), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
C9orf72 (203228)
Length:
3356
CDS:
203..1648

Additional Resources:

NCBI RefSeq record:
NM_001256054.2
NBCI Gene record:
C9orf72 (203228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267379 GGGCGATCTTAACATAATAAT pLKO_005 1528 CDS 100% 15.000 21.000 N 3110043O21Rik n/a
2 TRCN0000147741 CGAAAGCTTTACTCCTGATTT pLKO.1 1273 CDS 100% 13.200 9.240 N C9orf72 n/a
3 TRCN0000149351 GCCAAGACAGAGATTGCTTTA pLKO.1 239 CDS 100% 10.800 7.560 N C9orf72 n/a
4 TRCN0000127519 CAATGCCATCAGCTCACACTT pLKO.1 865 CDS 100% 4.950 3.465 N C9orf72 n/a
5 TRCN0000148858 CCACTGAACTAGATGACTGTT pLKO.1 3078 3UTR 100% 4.950 3.465 N C9orf72 n/a
6 TRCN0000148881 CCACTTCATAGAGTGTGTGTT pLKO.1 578 CDS 100% 4.950 3.465 N C9orf72 n/a
7 TRCN0000130210 CCAGGTTATGTGAAGCAGAAT pLKO.1 990 CDS 100% 4.950 3.465 N C9orf72 n/a
8 TRCN0000127899 CCTGGGATTCAGTCTGTAGAA pLKO.1 2222 3UTR 100% 4.950 3.465 N C9orf72 n/a
9 TRCN0000149756 GCAAGTCATGTATGCTCCATA pLKO.1 1090 CDS 100% 4.950 3.465 N C9orf72 n/a
10 TRCN0000130180 CCACAGAAAGAAAGTGAGCTT pLKO.1 2114 3UTR 100% 2.640 1.848 N C9orf72 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05210 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05210 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471027 CTCATTGCAGACATACATACAACT pLX_317 30% 100% 100% V5 n/a
Download CSV