Transcript: Human NM_001256090.2

Homo sapiens activating transcription factor 2 (ATF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ATF2 (1386)
Length:
4199
CDS:
332..1849

Additional Resources:

NCBI RefSeq record:
NM_001256090.2
NBCI Gene record:
ATF2 (1386)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256090.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013713 GCGAAATCTGTGGTTGTAAAT pLKO.1 1931 3UTR 100% 13.200 18.480 N ATF2 n/a
2 TRCN0000219047 TGCGAAATCTGTGGTTGTAAA pLKO_005 1930 3UTR 100% 13.200 18.480 N ATF2 n/a
3 TRCN0000374121 TGCGAAATCTGTGGTTGTAAA pLKO_005 1930 3UTR 100% 13.200 18.480 N Atf2 n/a
4 TRCN0000229648 ATGAGTTGGCGAGTCCATTTG pLKO_005 588 CDS 100% 10.800 15.120 N ATF2 n/a
5 TRCN0000013716 GCAGCTAACGAAGATCCTGAT pLKO.1 1367 CDS 100% 4.050 3.240 N ATF2 n/a
6 TRCN0000229649 CTCTTGCAACACCTATCATAA pLKO_005 669 CDS 100% 13.200 9.240 N ATF2 n/a
7 TRCN0000013715 CCATCCTCTAACAGGCCAATT pLKO.1 935 CDS 100% 10.800 7.560 N ATF2 n/a
8 TRCN0000218254 TGCTCTTTCACAGATCGTTAT pLKO_005 1792 CDS 100% 10.800 7.560 N ATF2 n/a
9 TRCN0000082080 CCTCCAGTTACCAATGGTGAT pLKO.1 1190 CDS 100% 4.050 2.835 N Atf2 n/a
10 TRCN0000013714 GCATCATTACAGGTTCCCAAT pLKO.1 830 CDS 100% 4.050 2.835 N ATF2 n/a
11 TRCN0000013717 GCTCATAAAGATTGCCCTGTA pLKO.1 1571 CDS 100% 4.050 2.835 N ATF2 n/a
12 TRCN0000218996 GCTATCATACTGCTGATAAAG pLKO_005 1614 CDS 100% 1.320 0.924 N ATF2 n/a
13 TRCN0000082082 CTGGCTATCATACTGCTGATA pLKO.1 1611 CDS 100% 0.495 0.347 N Atf2 n/a
14 TRCN0000365934 TTGCTATTCCTGCATCAATTA pLKO_005 1017 CDS 100% 13.200 7.920 N Atf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256090.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00361 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00361 pLX_304 44.6% 100% 100% V5 n/a
3 TRCN0000469368 TCGCTTTTGTCGAGAGAGTTTCCG pLX_317 30.8% 100% 100% V5 n/a
4 ccsbBroadEn_10749 pDONR223 100% 41.3% 41.3% None 627_1515delinsG n/a
5 ccsbBroad304_10749 pLX_304 0% 41.3% 41.3% V5 627_1515delinsG n/a
6 TRCN0000468300 CCCGGTGGTGACCGCTCCGGTCGA pLX_317 57.9% 41.3% 41.3% V5 627_1515delinsG n/a
Download CSV