Transcript: Human NM_001256127.2

Homo sapiens NOP2/Sun RNA methyltransferase 4 (NSUN4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
NSUN4 (387338)
Length:
5056
CDS:
743..1750

Additional Resources:

NCBI RefSeq record:
NM_001256127.2
NBCI Gene record:
NSUN4 (387338)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164586 CGAACCTTCGATGCTTCACTT pLKO.1 975 CDS 100% 4.950 6.930 N NSUN4 n/a
2 TRCN0000161547 GCTAGGAAGATGGAGCTTTAA pLKO.1 3152 3UTR 100% 13.200 9.240 N NSUN4 n/a
3 TRCN0000160114 CGGCAATAAGAAGTAGAAGAT pLKO.1 1884 3UTR 100% 4.950 3.465 N NSUN4 n/a
4 TRCN0000163332 CTTCACAGCTATGTGCCTGAA pLKO.1 1244 CDS 100% 4.050 2.835 N NSUN4 n/a
5 TRCN0000159182 GATGGAAATCAAGTTCGAGTT pLKO.1 1274 CDS 100% 4.050 2.835 N NSUN4 n/a
6 TRCN0000097370 GCTGGTAATACCAAACCTCAT pLKO.1 1681 CDS 100% 4.050 2.835 N Nsun4 n/a
7 TRCN0000160972 GCTGGTAATACCAAACCTCAT pLKO.1 1681 CDS 100% 4.050 2.835 N NSUN4 n/a
8 TRCN0000309585 GCTGGTAATACCAAACCTCAT pLKO_005 1681 CDS 100% 4.050 2.835 N Nsun4 n/a
9 TRCN0000161196 GCACTGGTCAATAACTTTGCT pLKO.1 818 CDS 100% 3.000 2.100 N NSUN4 n/a
10 TRCN0000160115 CCCTTTCTAAATGAAAGGTTT pLKO.1 3779 3UTR 100% 0.495 0.347 N NSUN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10083 pDONR223 100% 87% 86.7% None 0_1ins147;4A>G;863A>G n/a
2 ccsbBroad304_10083 pLX_304 0% 87% 86.7% V5 0_1ins147;4A>G;863A>G n/a
3 TRCN0000478407 GCACAAGCCTGAAGCTTCGCTAGC pLX_317 29.7% 87% 86.7% V5 0_1ins147;4A>G;863A>G n/a
Download CSV