Transcript: Human NM_001256270.1

Homo sapiens kinesin family member 22 (KIF22), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
KIF22 (3835)
Length:
2296
CDS:
389..2182

Additional Resources:

NCBI RefSeq record:
NM_001256270.1
NBCI Gene record:
KIF22 (3835)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441131 AGCAAGCTCACTCGCCTATTG pLKO_005 1151 CDS 100% 10.800 15.120 N KIF22 n/a
2 TRCN0000438029 CAACAAGGGCCTTCGGCTAAA pLKO_005 1039 CDS 100% 10.800 15.120 N KIF22 n/a
3 TRCN0000438568 GCTGTCGGCTAAGCAAGATTG pLKO_005 264 5UTR 100% 10.800 15.120 N KIF22 n/a
4 TRCN0000108401 CAGTATCCTTATTGCCAACAT pLKO.1 1198 CDS 100% 4.950 6.930 N KIF22 n/a
5 TRCN0000108402 CCACCAGGAGACTCTCAAATA pLKO.1 427 CDS 100% 13.200 9.240 N KIF22 n/a
6 TRCN0000442667 CAGTCTCCGCACTCAACTTTG pLKO_005 1248 CDS 100% 10.800 7.560 N KIF22 n/a
7 TRCN0000108400 CCTAGAGATTGAGAGGCTTAA pLKO.1 1621 CDS 100% 10.800 7.560 N KIF22 n/a
8 TRCN0000436991 GGTCCAAGGAGGTGATCAATC pLKO_005 1275 CDS 100% 10.800 7.560 N KIF22 n/a
9 TRCN0000428548 GTACTCAGCAGGACATCTATG pLKO_005 477 CDS 100% 10.800 7.560 N KIF22 n/a
10 TRCN0000421984 AGTGGTAGATGCGCTGAATCA pLKO_005 1102 CDS 100% 4.950 3.465 N KIF22 n/a
11 TRCN0000091149 CCTGTTAAGCTGTCTCAGAAA pLKO.1 1337 CDS 100% 4.950 3.465 N Kif22 n/a
12 TRCN0000303168 CCTGTTAAGCTGTCTCAGAAA pLKO_005 1337 CDS 100% 4.950 3.465 N Kif22 n/a
13 TRCN0000108404 CCTACAGAAGCTAAGCAGCAT pLKO.1 1468 CDS 100% 2.640 1.848 N KIF22 n/a
14 TRCN0000108403 GACCTAGAGATTGAGAGGCTT pLKO.1 1619 CDS 100% 2.640 1.848 N KIF22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00913 pDONR223 100% 89.6% 89.7% None 0_1ins204;1026C>T;1221G>A n/a
2 ccsbBroad304_00913 pLX_304 0% 89.6% 89.7% V5 0_1ins204;1026C>T;1221G>A n/a
3 TRCN0000473457 CCGAAACTCTGCGAGGCCGGTAAT pLX_317 21.8% 89.6% 89.7% V5 0_1ins204;1026C>T;1221G>A n/a
Download CSV