Transcript: Human NM_001256299.3

Homo sapiens LINC02210-CRHR1 readthrough (LINC02210-CRHR1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
LINC02210-CRHR1 (104909134)
Length:
2695
CDS:
909..1631

Additional Resources:

NCBI RefSeq record:
NM_001256299.3
NBCI Gene record:
LINC02210-CRHR1 (104909134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356855 GACATGGGAATGAATTGAAAT pLKO_005 1889 3UTR 100% 13.200 6.600 Y CRHR1 n/a
2 TRCN0000356857 TCCTGGTCCTGCTGATCAATT pLKO_005 1213 CDS 100% 13.200 6.600 Y CRHR1 n/a
3 TRCN0000356854 TCTATGGTGTCCGCTACAATA pLKO_005 598 5UTR 100% 13.200 6.600 Y CRHR1 n/a
4 TRCN0000356917 GTTCTACTGTTTCCTCAATAG pLKO_005 1466 CDS 100% 10.800 5.400 Y CRHR1 n/a
5 TRCN0000011295 CCGCTACAATACCACAAACAA pLKO.1 608 5UTR 100% 5.625 2.813 Y CRHR1 n/a
6 TRCN0000011294 GAGACAGAAGTCAGGTGTCAT pLKO.1 2150 3UTR 100% 4.950 2.475 Y CRHR1 n/a
7 TRCN0000011298 GAGATCCTCAATGAGGAGAAA pLKO.1 693 5UTR 100% 4.950 2.475 Y CRHR1 n/a
8 TRCN0000011297 GCTGCGCAAATGGATGTTCAT pLKO.1 1058 CDS 100% 4.950 2.475 Y CRHR1 n/a
9 TRCN0000011296 CGACAATGAGAAGTGCTGGTT pLKO.1 1142 CDS 100% 2.640 1.320 Y CRHR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489110 ATCCGTGTTTTGCTAGACCATCTC pLX_317 29.7% 57.8% 57.8% V5 (not translated due to prior stop codon) 0_1ins525 n/a
2 TRCN0000489626 TTGCTAGTATCTTCGAGTTCCGGG pLX_317 28.1% 57.7% 57.6% V5 0_1ins525;720_721insG n/a
Download CSV