Transcript: Human NM_001256396.2

Homo sapiens Rh family B glycoprotein (gene/pseudogene) (RHBG), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RHBG (57127)
Length:
1863
CDS:
203..1489

Additional Resources:

NCBI RefSeq record:
NM_001256396.2
NBCI Gene record:
RHBG (57127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059422 CCTGGCGAGCATGAGGATAAA pLKO.1 1424 CDS 100% 13.200 18.480 N RHBG n/a
2 TRCN0000059419 CGTCTACCATTCAGACCTCTT pLKO.1 754 CDS 100% 4.050 5.670 N RHBG n/a
3 TRCN0000059420 GTACAAGTTCTTCACGCCCAT pLKO.1 1075 CDS 100% 2.160 3.024 N RHBG n/a
4 TRCN0000059418 GCTGTTTGTCACACTGATGTT pLKO.1 1300 CDS 100% 4.950 3.465 N RHBG n/a
5 TRCN0000059421 GAGCATGATCAATGCTGACTT pLKO.1 484 CDS 100% 0.495 0.347 N RHBG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14225 pDONR223 100% 79.5% 75.2% None (many diffs) n/a
2 ccsbBroad304_14225 pLX_304 0% 79.5% 75.2% V5 (many diffs) n/a
3 TRCN0000480931 TACAAAACACCTACGCGAAAATAC pLX_317 33.3% 79.5% 75.2% V5 (many diffs) n/a
Download CSV