Transcript: Human NM_001256441.2

Homo sapiens chromosome 19 open reading frame 47 (C19orf47), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
C19orf47 (126526)
Length:
3611
CDS:
108..1265

Additional Resources:

NCBI RefSeq record:
NM_001256441.2
NBCI Gene record:
C19orf47 (126526)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231830 ACACCACGACAGGGAGTAAAC pLKO_005 751 CDS 100% 10.800 15.120 N C19orf47 n/a
2 TRCN0000231832 GAGGTCAAGGTCACCATTAAG pLKO_005 1134 CDS 100% 13.200 10.560 N C19orf47 n/a
3 TRCN0000231831 AGCCGGAGTCCTTGTCTAAAG pLKO_005 1024 CDS 100% 10.800 8.640 N C19orf47 n/a
4 TRCN0000231829 GCATGCTGCTGGATCTCAATA pLKO_005 226 CDS 100% 13.200 9.240 N C19orf47 n/a
5 TRCN0000231833 TCTCTCCCTGTCTTCACTTTG pLKO_005 1741 3UTR 100% 10.800 6.480 N C19orf47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04816 pDONR223 100% 92.2% 92.2% None 1_90del n/a
2 ccsbBroad304_04816 pLX_304 0% 92.2% 92.2% V5 1_90del n/a
3 TRCN0000468059 GCCCTATACCGAAGATCCTGGTTA pLX_317 29.4% 92.2% 92.2% V5 1_90del n/a
4 ccsbBroadEn_16085 pDONR223 0% 72.9% 72.9% None 1_312del n/a
5 ccsbBroad304_16085 pLX_304 0% 72.9% 72.9% V5 1_312del n/a
6 TRCN0000473304 CTTGCCTGACGGCTTACTTCGTGG pLX_317 48.5% 72.9% 72.9% V5 1_312del n/a
Download CSV