Transcript: Human NM_001256484.2

Homo sapiens epoxide hydrolase 2 (EPHX2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
EPHX2 (2053)
Length:
2774
CDS:
224..1732

Additional Resources:

NCBI RefSeq record:
NM_001256484.2
NBCI Gene record:
EPHX2 (2053)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439761 GTCAGGTGGGAATGGTCAAAC pLKO_005 525 CDS 100% 10.800 15.120 N EPHX2 n/a
2 TRCN0000050554 CCGGCTTATGAAAGGAGAGAT pLKO.1 217 5UTR 100% 4.950 6.930 N EPHX2 n/a
3 TRCN0000414811 CCATGGGTACGTGACAGTAAA pLKO_005 778 CDS 100% 13.200 10.560 N EPHX2 n/a
4 TRCN0000417551 GGGCACCATTCTTAGTATACA pLKO_005 1783 3UTR 100% 5.625 4.500 N EPHX2 n/a
5 TRCN0000434670 ATGAATGCATCGTCCCTTTAT pLKO_005 1949 3UTR 100% 13.200 9.240 N EPHX2 n/a
6 TRCN0000417482 ATATTGCATGGAAGTGTTATG pLKO_005 985 CDS 100% 10.800 7.560 N EPHX2 n/a
7 TRCN0000443272 CAGAACCTGAGTCGGACTTTC pLKO_005 1259 CDS 100% 10.800 7.560 N EPHX2 n/a
8 TRCN0000437939 GTCATCTGCTCCTCCCGAAAT pLKO_005 958 CDS 100% 10.800 7.560 N EPHX2 n/a
9 TRCN0000050556 CTGGTTTCAGAGGTCCTCTAA pLKO.1 1434 CDS 100% 4.950 3.465 N EPHX2 n/a
10 TRCN0000050557 GAGGTGAATCAGATCCTCATT pLKO.1 1661 CDS 100% 4.950 3.465 N EPHX2 n/a
11 TRCN0000050555 GAAATCTTTGACAAGGCGATT pLKO.1 332 CDS 100% 4.050 2.835 N EPHX2 n/a
12 TRCN0000050553 GCTATGGACATGAAAGGCTAT pLKO.1 932 CDS 100% 4.050 2.835 N EPHX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00510 pDONR223 100% 90.4% 90.4% None 0_1ins159 n/a
2 ccsbBroad304_00510 pLX_304 0% 90.4% 90.4% V5 0_1ins159 n/a
3 TRCN0000476514 AATTCTGTCTGTGTGGCATGGTGT pLX_317 21.6% 90.4% 90.4% V5 0_1ins159 n/a
Download CSV