Transcript: Human NM_001256496.1

Homo sapiens mannosidase alpha class 2C member 1 (MAN2C1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
MAN2C1 (4123)
Length:
2994
CDS:
45..2870

Additional Resources:

NCBI RefSeq record:
NM_001256496.1
NBCI Gene record:
MAN2C1 (4123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417214 AGCGACCTACCCACTACAATA pLKO_005 2248 CDS 100% 13.200 18.480 N MAN2C1 n/a
2 TRCN0000049610 CGAGTTCACCTATGCACTGAT pLKO.1 2453 CDS 100% 4.950 6.930 N MAN2C1 n/a
3 TRCN0000429612 GGGAACCAGTTTGTGCTATTT pLKO_005 1914 CDS 100% 13.200 10.560 N MAN2C1 n/a
4 TRCN0000416115 ACATCCGTTCCCATGGCAATA pLKO_005 1540 CDS 100% 10.800 8.640 N MAN2C1 n/a
5 TRCN0000049608 GCCACCTATGAGATCCAGTTT pLKO.1 2217 CDS 100% 4.950 3.465 N MAN2C1 n/a
6 TRCN0000049609 CCAGAAATTGAGCTGGAATTT pLKO.1 929 CDS 100% 1.320 0.924 N MAN2C1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00972 pDONR223 100% 90.4% 90.4% None 598_599ins297 n/a
2 ccsbBroad304_00972 pLX_304 0% 90.4% 90.4% V5 598_599ins297 n/a
3 TRCN0000468851 CATTCGAGTAAATACTCTAGCGTC pLX_317 13.2% 90.4% 90.4% V5 598_599ins297 n/a
Download CSV