Transcript: Human NM_001256617.1

Homo sapiens tubulin gamma complex associated protein 2 (TUBGCP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
TUBGCP2 (10844)
Length:
4302
CDS:
374..3166

Additional Resources:

NCBI RefSeq record:
NM_001256617.1
NBCI Gene record:
TUBGCP2 (10844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139403 CGACTTCTTCGTGCACTTCAT pLKO.1 2032 CDS 100% 4.950 6.930 N TUBGCP2 n/a
2 TRCN0000139732 CCAGGAGGATTACAACGACAA pLKO.1 1714 CDS 100% 4.050 5.670 N TUBGCP2 n/a
3 TRCN0000145109 GTACTCCAGAAGACTTTCTAA pLKO.1 546 CDS 100% 5.625 4.500 N TUBGCP2 n/a
4 TRCN0000140130 GCAGATCGAGAAGGCGTTTAA pLKO.1 1915 CDS 100% 13.200 9.240 N TUBGCP2 n/a
5 TRCN0000140549 GCAGCAGTCTCTGGAACTTAA pLKO.1 823 CDS 100% 13.200 9.240 N TUBGCP2 n/a
6 TRCN0000142644 GCTCAACTTCGTCCAGAATAT pLKO.1 2515 CDS 100% 13.200 9.240 N TUBGCP2 n/a
7 TRCN0000144653 GCTTGACTTCAATGGTTTCTA pLKO.1 3031 CDS 100% 5.625 3.938 N TUBGCP2 n/a
8 TRCN0000139220 CGGTGGCTAAAGAGATCATCT pLKO.1 1866 CDS 100% 4.950 3.465 N TUBGCP2 n/a
9 TRCN0000140438 GCTGGTGTACCTGTTGTCAAA pLKO.1 613 CDS 100% 4.950 3.465 N TUBGCP2 n/a
10 TRCN0000139329 CCAGGCTTGACTTCAATGGTT pLKO.1 3027 CDS 100% 3.000 2.100 N TUBGCP2 n/a
11 TRCN0000140959 CAGCAGTCTCTGGAACTTAAA pLKO.1 824 CDS 100% 13.200 7.920 N TUBGCP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07689 pDONR223 100% 96.8% 96.8% None (many diffs) n/a
2 ccsbBroad304_07689 pLX_304 0% 96.8% 96.8% V5 (many diffs) n/a
3 TRCN0000477016 CCGGCCGTAATACAAAGCCAGACC pLX_317 17.5% 96.8% 96.8% V5 (many diffs) n/a
Download CSV