Transcript: Human NM_001256710.1

Homo sapiens anaphase promoting complex subunit 10 (ANAPC10), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ANAPC10 (10393)
Length:
1506
CDS:
113..457

Additional Resources:

NCBI RefSeq record:
NM_001256710.1
NBCI Gene record:
ANAPC10 (10393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004433 ACAAGGCATCCGTTATATCTA pLKO.1 788 3UTR 100% 5.625 7.875 N ANAPC10 n/a
2 TRCN0000010876 TGGAGTGGATCAGTTACGAGA pLKO.1 232 CDS 100% 2.640 3.696 N ANAPC10 n/a
3 TRCN0000315083 TCTCAGTCAGAGTAGGAAATA pLKO_005 393 CDS 100% 13.200 10.560 N ANAPC10 n/a
4 TRCN0000004432 CAGTCAGAGTAGGAAATAATT pLKO.1 396 CDS 100% 15.000 10.500 N ANAPC10 n/a
5 TRCN0000315145 CCCTTAACTGACAATCATAAG pLKO_005 517 3UTR 100% 10.800 7.560 N ANAPC10 n/a
6 TRCN0000315080 GTACATTCATGATACAGATTG pLKO_005 548 3UTR 100% 10.800 7.560 N ANAPC10 n/a
7 TRCN0000315081 TTCTAGCCAATCACCAGAATG pLKO_005 572 3UTR 100% 10.800 7.560 N ANAPC10 n/a
8 TRCN0000004434 GACAATCATAAGAAGCCAACT pLKO.1 526 3UTR 100% 4.050 2.835 N ANAPC10 n/a
9 TRCN0000004431 AGTACGGGAAATTGGGTCACA pLKO.1 175 CDS 100% 2.640 1.848 N ANAPC10 n/a
10 TRCN0000315139 ACAACAGTGAAGACATTATGT pLKO_005 326 CDS 100% 5.625 3.375 N ANAPC10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02418 pDONR223 100% 60.1% 60.5% None (many diffs) n/a
2 ccsbBroad304_02418 pLX_304 0% 60.1% 60.5% V5 (many diffs) n/a
3 TRCN0000473829 CATAGCCTTGAACAAGGAGAACCC pLX_317 94.4% 60.1% 60.5% V5 (many diffs) n/a
4 TRCN0000489733 CCGTTTTCCGCGAATTTCCTCTGT pLX_317 64.2% 60.1% 60.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV