Transcript: Human NM_001256720.2

Homo sapiens C-type lectin domain containing 19A (CLEC19A), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
CLEC19A (728276)
Length:
2546
CDS:
122..682

Additional Resources:

NCBI RefSeq record:
NM_001256720.2
NBCI Gene record:
CLEC19A (728276)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157903 CGACCTCTACTGTTCTGAGTT pLKO.1 313 CDS 100% 4.950 6.930 N UNQ5810 n/a
2 TRCN0000156709 CACTGCTATCGATTCTTCCCT pLKO.1 269 CDS 100% 0.750 0.600 N UNQ5810 n/a
3 TRCN0000158265 CAAAGGCCACTGCTATCGATT pLKO.1 262 CDS 100% 4.950 3.465 N UNQ5810 n/a
4 TRCN0000152044 CACAAACAGACATCAGTATCA pLKO.1 183 CDS 100% 4.950 3.465 N UNQ5810 n/a
5 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 1497 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
6 TRCN0000157937 CCTTCATGATCACAGACAGGT pLKO.1 451 CDS 100% 2.640 1.848 N UNQ5810 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1806 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10664 pDONR223 100% 66.5% 65% None (many diffs) n/a
2 ccsbBroad304_10664 pLX_304 0% 66.5% 65% V5 (many diffs) n/a
3 TRCN0000469192 GCCGCCACACTCGGCTTAGATCTC pLX_317 89.9% 56.3% 45.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV