Transcript: Human NM_001256811.2

Homo sapiens glutamate metabotropic receptor 4 (GRM4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
GRM4 (2914)
Length:
7293
CDS:
502..3099

Additional Resources:

NCBI RefSeq record:
NM_001256811.2
NBCI Gene record:
GRM4 (2914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357379 CGCTATGACATCTACCAATAC pLKO_005 1780 CDS 100% 10.800 15.120 N GRM4 n/a
2 TRCN0000009020 GCGCTATGACATCTACCAATA pLKO.1 1779 CDS 100% 10.800 15.120 N GRM4 n/a
3 TRCN0000009021 GCACCTTAGAATAGAGCGGAT pLKO.1 1857 CDS 100% 2.160 3.024 N GRM4 n/a
4 TRCN0000357378 CAAGCCCTGTGGAGAACTTAA pLKO_005 693 CDS 100% 13.200 9.240 N GRM4 n/a
5 TRCN0000367842 GACCACCTGCACCTTAGAATA pLKO_005 1849 CDS 100% 13.200 9.240 N GRM4 n/a
6 TRCN0000367787 CTGCCGAGTACAAGGTCATTG pLKO_005 1817 CDS 100% 10.800 7.560 N GRM4 n/a
7 TRCN0000009022 CCTGTGACCTTCAATGAGAAT pLKO.1 1744 CDS 100% 4.950 3.465 N GRM4 n/a
8 TRCN0000011673 GCAGCCTCAAAGCCGTCGTTA pLKO.1 2933 CDS 100% 1.650 1.155 N GRM4 n/a
9 TRCN0000009019 GCCCTGTCTTTCTGTTCTCTT pLKO.1 3458 3UTR 100% 4.950 2.970 N GRM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00694 pDONR223 100% 94.8% 94.7% None 1027_1028ins141 n/a
2 ccsbBroad304_00694 pLX_304 0% 94.8% 94.7% V5 1027_1028ins141 n/a
3 TRCN0000469136 TGTCAGTACCAAATCGTACCCGTT pLX_317 16.6% 94.8% 94.7% V5 1027_1028ins141 n/a
4 ccsbBroadEn_15435 pDONR223 0% 94.8% 94.7% None 306C>T;1027_1028ins141 n/a
5 ccsbBroad304_15435 pLX_304 0% 94.8% 94.7% V5 306C>T;1027_1028ins141 n/a
6 TRCN0000473211 TAGCCGACCTATAATCGACGCAGA pLX_317 17.3% 94.8% 94.7% V5 306C>T;1027_1028ins141 n/a
7 TRCN0000488196 GAAGCCAATACTTTCTTAAATTAT pLX_317 10.8% 94.7% 94.7% V5 (not translated due to prior stop codon) 660T>C;1027_1028ins141;1317T>C n/a
8 TRCN0000489621 TGTCGATCGCGCACCGGAACAAAA pLX_317 12.5% 94.7% 94.6% V5 (many diffs) n/a
Download CSV