Transcript: Human NM_001256865.1

Homo sapiens DnaJ heat shock protein family (Hsp40) member C6 (DNAJC6), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
DNAJC6 (9829)
Length:
5916
CDS:
370..3072

Additional Resources:

NCBI RefSeq record:
NM_001256865.1
NBCI Gene record:
DNAJC6 (9829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284758 CACGATGCATACCGTACTATG pLKO_005 2844 CDS 100% 10.800 15.120 N DNAJC6 n/a
2 TRCN0000001903 GCCTCTCACAATTAAGTCGAT pLKO.1 1017 CDS 100% 2.640 3.696 N DNAJC6 n/a
3 TRCN0000272428 GCCTCTCACAATTAAGTCGAT pLKO_005 1017 CDS 100% 2.640 3.696 N DNAJC6 n/a
4 TRCN0000272478 TTGTCTGAGAATAGGATTAAT pLKO_005 3412 3UTR 100% 15.000 10.500 N DNAJC6 n/a
5 TRCN0000001902 CGTGGGAAAGGATCAAGTAAT pLKO.1 2626 CDS 100% 13.200 9.240 N DNAJC6 n/a
6 TRCN0000272426 CGTGGGAAAGGATCAAGTAAT pLKO_005 2626 CDS 100% 13.200 9.240 N DNAJC6 n/a
7 TRCN0000379872 TTTGCTGTGTGTCGGAATATG pLKO_005 754 CDS 100% 13.200 9.240 N DNAJC6 n/a
8 TRCN0000010666 CCTTCTGACATGATTTACTTT pLKO.1 5384 3UTR 100% 5.625 3.938 N DNAJC6 n/a
9 TRCN0000001905 CACTTATGTTACCTCCAGAAT pLKO.1 528 CDS 100% 4.950 3.465 N DNAJC6 n/a
10 TRCN0000001904 CCAGCTACACAAAGGGAGATT pLKO.1 500 CDS 100% 4.950 3.465 N DNAJC6 n/a
11 TRCN0000272480 CCAGCTACACAAAGGGAGATT pLKO_005 500 CDS 100% 4.950 3.465 N DNAJC6 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5498 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256865.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11419 pDONR223 100% 92.7% 92.7% None 0_1ins210;1290G>A;1800A>C n/a
2 ccsbBroad304_11419 pLX_304 0% 92.7% 92.7% V5 0_1ins210;1290G>A;1800A>C n/a
3 TRCN0000467752 GTAATATTCCAGCCTGGATTACCT pLX_317 13.5% 92.7% 92.7% V5 0_1ins210;1290G>A;1800A>C n/a
Download CSV