Transcript: Human NM_001257210.1

Homo sapiens fibroblast growth factor 1 (FGF1), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
FGF1 (2246)
Length:
3812
CDS:
224..691

Additional Resources:

NCBI RefSeq record:
NM_001257210.1
NBCI Gene record:
FGF1 (2246)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001257210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072524 GCCCTGACCGAGAAGTTTAAT pLKO.1 254 CDS 100% 15.000 10.500 N FGF1 n/a
2 TRCN0000222593 CCTGATAACAAGCAAGGATAT pLKO.1 1422 3UTR 100% 10.800 7.560 N FGF1 n/a
3 TRCN0000072525 CAAACTCCTCTACTGTAGCAA pLKO.1 301 CDS 100% 3.000 2.100 N FGF1 n/a
4 TRCN0000222594 GAGAAGTTTAATCTGCCTCCA pLKO.1 263 CDS 100% 2.160 1.512 N FGF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001257210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00555 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00555 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472643 ATTACATTAGCCCAGACCCTGCCG pLX_317 73.8% 100% 100% V5 n/a
Download CSV