Transcript: Human NM_001257326.2

Homo sapiens amyloid beta precursor protein binding family B member 1 (APBB1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
APBB1 (322)
Length:
2122
CDS:
342..1697

Additional Resources:

NCBI RefSeq record:
NM_001257326.2
NBCI Gene record:
APBB1 (322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001257326.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083494 CCAGAAGTTCCAAGTCTATTA pLKO.1 1184 CDS 100% 13.200 9.240 N APBB1 n/a
2 TRCN0000083495 GCATGAGATCTGCTCTAAGAT pLKO.1 1049 CDS 100% 5.625 3.938 N APBB1 n/a
3 TRCN0000083496 CCTGCATGAGATCTGCTCTAA pLKO.1 1046 CDS 100% 4.950 3.465 N APBB1 n/a
4 TRCN0000083493 GTGATAACACTGGAGTGGTAA pLKO.1 1877 3UTR 100% 4.950 3.465 N APBB1 n/a
5 TRCN0000375281 TGCTCAAGTGCCACGTGTTTC pLKO_005 991 CDS 100% 10.800 6.480 N Apbb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001257326.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00076 pDONR223 100% 63.2% 63.2% None 0_1ins777;604_609delAGAGAG n/a
2 ccsbBroad304_00076 pLX_304 0% 63.2% 63.2% V5 0_1ins777;604_609delAGAGAG n/a
3 TRCN0000479791 AAGTGCTCTTAAAATGCCCAGAAG pLX_317 19.9% 63.2% 63.2% V5 0_1ins777;604_609delAGAGAG n/a
Download CSV