Transcript: Human NM_001257342.2

Homo sapiens BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone (BCS1L), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
BCS1L (617)
Length:
1557
CDS:
241..1500

Additional Resources:

NCBI RefSeq record:
NM_001257342.2
NBCI Gene record:
BCS1L (617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001257342.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284809 AGACGTGGCTACCTGCTTTAT pLKO_005 907 CDS 100% 13.200 18.480 N BCS1L n/a
2 TRCN0000272651 GCCGCATTTCCACTAAGTTTG pLKO_005 506 CDS 100% 10.800 15.120 N BCS1L n/a
3 TRCN0000272702 GTCGAGAGATGCAGATGATAG pLKO_005 593 CDS 100% 10.800 15.120 N BCS1L n/a
4 TRCN0000006727 CCTTCGAGCTACAAACCAGAT pLKO.1 1392 CDS 100% 4.050 3.240 N BCS1L n/a
5 TRCN0000272701 CCTTCGAGCTACAAACCAGAT pLKO_005 1392 CDS 100% 4.050 3.240 N BCS1L n/a
6 TRCN0000006729 GCTGAGAACTTTGCAGAACAT pLKO.1 1369 CDS 100% 4.950 3.465 N BCS1L n/a
7 TRCN0000284812 GCTGAGAACTTTGCAGAACAT pLKO_005 1369 CDS 100% 4.950 3.465 N BCS1L n/a
8 TRCN0000006730 CCAGTAAAGTACCAAGGCCTA pLKO.1 1132 CDS 100% 2.160 1.512 N BCS1L n/a
9 TRCN0000006728 CGTCCAGGAATTCATCGATAA pLKO.1 852 CDS 100% 0.000 0.000 N BCS1L n/a
10 TRCN0000006731 CTGAAGGACAATCCCTACTTT pLKO.1 268 CDS 100% 5.625 3.375 N BCS1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001257342.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00158 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00158 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467381 CTTTACTACACTGCTCCGGAAGTG pLX_317 30.4% 100% 100% V5 n/a
Download CSV