Transcript: Human NM_001258281.1

Homo sapiens mutS homolog 2 (MSH2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
MSH2 (4436)
Length:
3042
CDS:
140..2746

Additional Resources:

NCBI RefSeq record:
NM_001258281.1
NBCI Gene record:
MSH2 (4436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039671 GCATGTAATAGAGTGTGCTAA pLKO.1 2455 CDS 100% 4.950 6.930 N MSH2 n/a
2 TRCN0000010384 ATTCATGTTGCAGAGCTTGCT pLKO.1 2423 CDS 100% 2.640 3.696 N MSH2 n/a
3 TRCN0000344496 ATTCATGTTGCAGAGCTTGCT pLKO_005 2423 CDS 100% 2.640 3.696 N MSH2 n/a
4 TRCN0000039670 GCCTTGCTGAATAAGTGTAAA pLKO.1 923 CDS 100% 13.200 10.560 N MSH2 n/a
5 TRCN0000332891 GCCTTGCTGAATAAGTGTAAA pLKO_005 923 CDS 100% 13.200 10.560 N MSH2 n/a
6 TRCN0000010385 TTGCAATTGACATAGGCAATA pLKO.1 2952 3UTR 100% 10.800 7.560 N MSH2 n/a
7 TRCN0000344497 TTGCAATTGACATAGGCAATA pLKO_005 2952 3UTR 100% 10.800 7.560 N MSH2 n/a
8 TRCN0000039668 CCAGTAATGGAATGAAGGTAA pLKO.1 2753 3UTR 100% 4.950 3.465 N MSH2 n/a
9 TRCN0000039669 CCTGGCAATCTCTCTCAGTTT pLKO.1 314 CDS 100% 4.950 3.465 N MSH2 n/a
10 TRCN0000332958 CCTGGCAATCTCTCTCAGTTT pLKO_005 314 CDS 100% 4.950 3.465 N MSH2 n/a
11 TRCN0000039672 GCCAGTATATGAAATTGGATA pLKO.1 831 CDS 100% 4.950 3.465 N MSH2 n/a
12 TRCN0000010383 TATAAGGCTTCTCCTGGCAAT pLKO.1 302 CDS 100% 4.050 2.835 N MSH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258281.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01034 pDONR223 100% 92.9% 92.9% None 0_1ins198 n/a
2 ccsbBroad304_01034 pLX_304 0% 92.9% 92.9% V5 0_1ins198 n/a
3 TRCN0000491945 TGCGAGGTAAGTAATATACCTCCG pLX_317 13% 92.9% 92.9% V5 0_1ins198 n/a
Download CSV