Transcript: Human NM_001258338.1

Homo sapiens NADH:ubiquinone oxidoreductase subunit A12 (NDUFA12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
NDUFA12 (55967)
Length:
504
CDS:
34..225

Additional Resources:

NCBI RefSeq record:
NM_001258338.1
NBCI Gene record:
NDUFA12 (55967)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064025 GATGCGAAGGTTGGTACATTA pLKO.1 127 CDS 100% 13.200 18.480 N NDUFA12 n/a
2 TRCN0000421654 ACCACTTACTGCTCGTAAATT pLKO_005 248 3UTR 100% 15.000 12.000 N NDUFA12 n/a
3 TRCN0000064026 TGACTGATGATCCTCCAACAA pLKO.1 223 CDS 100% 4.950 3.960 N NDUFA12 n/a
4 TRCN0000433833 ATTCATTTGGACGAACCATAA pLKO_005 266 3UTR 100% 10.800 7.560 N NDUFA12 n/a
5 TRCN0000413750 CATCGTTGGCTTCACAGTATG pLKO_005 204 CDS 100% 10.800 7.560 N NDUFA12 n/a
6 TRCN0000418750 ACCACTAGAAAGAAGATTCAG pLKO_005 330 3UTR 100% 4.950 3.465 N NDUFA12 n/a
7 TRCN0000064023 CCCAGAACAATATGTACCTTA pLKO.1 305 3UTR 100% 4.950 3.465 N NDUFA12 n/a
8 TRCN0000437803 GAGTGGATCCCACCTTCAACA pLKO_005 351 3UTR 100% 4.950 3.465 N NDUFA12 n/a
9 TRCN0000064027 CGAACCATAAATTCAACGTGA pLKO.1 277 3UTR 100% 2.640 1.848 N NDUFA12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08614 pDONR223 100% 43.4% 40% None 167_168ins88;189_190ins158 n/a
2 ccsbBroad304_08614 pLX_304 0% 43.4% 40% V5 167_168ins88;189_190ins158 n/a
3 TRCN0000467143 CTGAGTATGAATGCTAATCGCCCT pLX_317 93.8% 43.4% 40% V5 167_168ins88;189_190ins158 n/a
Download CSV