Transcript: Human NM_001258403.1

Homo sapiens solute carrier family 4 member 8 (SLC4A8), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
SLC4A8 (9498)
Length:
3131
CDS:
410..2653

Additional Resources:

NCBI RefSeq record:
NM_001258403.1
NBCI Gene record:
SLC4A8 (9498)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258403.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435122 TTTCATGACGTAGCATATAAG pLKO_005 1355 CDS 100% 13.200 9.240 N SLC4A8 n/a
2 TRCN0000043179 CCTCATTTGATGGATAAACAT pLKO.1 992 CDS 100% 5.625 3.938 N SLC4A8 n/a
3 TRCN0000043182 GCCTCTATTACTGCAGGTGTA pLKO.1 2145 CDS 100% 4.050 2.835 N SLC4A8 n/a
4 TRCN0000043181 GCTAAGGAGCTGCCTTATTAA pLKO.1 754 CDS 100% 1.500 1.050 N SLC4A8 n/a
5 TRCN0000043180 CCGTTTCACTGAAGAAGCATT pLKO.1 2020 CDS 100% 4.950 2.970 N SLC4A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258403.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11376 pDONR223 100% 78.6% 76.7% None (many diffs) n/a
2 ccsbBroad304_11376 pLX_304 0% 78.6% 76.7% V5 (many diffs) n/a
3 TRCN0000479470 ACCGACTGCAGAGTCTGTATAGTC pLX_317 19.1% 78.6% 76.7% V5 (many diffs) n/a
Download CSV