Transcript: Human NM_001260509.2

Homo sapiens potassium inwardly rectifying channel subfamily J member 3 (KCNJ3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
KCNJ3 (3760)
Length:
1031
CDS:
82..1008

Additional Resources:

NCBI RefSeq record:
NM_001260509.2
NBCI Gene record:
KCNJ3 (3760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001260509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044330 CCAATGTCTATAACTTCCCTT pLKO.1 455 CDS 100% 2.640 3.696 N KCNJ3 n/a
2 TRCN0000044331 CCTCACAATTTGCCACGTGAT pLKO.1 882 CDS 100% 4.050 2.835 N KCNJ3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001260509.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06476 pDONR223 100% 61.2% 60.8% None (many diffs) n/a
2 ccsbBroad304_06476 pLX_304 0% 61.2% 60.8% V5 (many diffs) n/a
3 TRCN0000468883 TTGTGATAATGCCGACTGATAATT pLX_317 29.6% 61.2% 60.8% V5 (many diffs) n/a
Download CSV