Transcript: Human NM_001261424.2

Homo sapiens protein phosphatase 1 regulatory inhibitor subunit 1C (PPP1R1C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
PPP1R1C (151242)
Length:
3027
CDS:
259..609

Additional Resources:

NCBI RefSeq record:
NM_001261424.2
NBCI Gene record:
PPP1R1C (151242)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001261424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359884 AGGAGCAGCGGGACCATTAAT pLKO_005 590 CDS 100% 15.000 10.500 N PPP1R1C n/a
2 TRCN0000359807 CTGTATTCCAGAGTCAGATTG pLKO_005 299 CDS 100% 10.800 7.560 N PPP1R1C n/a
3 TRCN0000052714 CCTGTATTCCAGAGTCAGATT pLKO.1 298 CDS 100% 4.950 3.465 N PPP1R1C n/a
4 TRCN0000052715 GAATCAGCATTCCCTGAAGAA pLKO.1 547 CDS 100% 4.950 3.465 N PPP1R1C n/a
5 TRCN0000052713 GCATCACTTGTGATTCTCAAT pLKO.1 385 CDS 100% 4.950 3.465 N PPP1R1C n/a
6 TRCN0000052716 CAGAGTCAGATTGCACCTGAA pLKO.1 307 CDS 100% 4.050 2.835 N PPP1R1C n/a
7 TRCN0000174190 CAGAGTCAGATTGCACCTGAA pLKO.1 307 CDS 100% 4.050 2.835 N PPP1R1C n/a
8 TRCN0000052717 CCTAAGCAAAGGAAGCAGAGT pLKO.1 475 CDS 100% 2.640 1.848 N PPP1R1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001261424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000481502 GGTCAACCAACAGGACACAGACGC pLX_317 98.2% 93.9% 93.9% V5 79_99del n/a
2 ccsbBroadEn_15267 pDONR223 96.8% 93.4% 50.8% None 79_99del;187_188insG;202_203insG n/a
3 ccsbBroad304_15267 pLX_304 0% 93.4% 50.8% V5 (not translated due to prior stop codon) 79_99del;187_188insG;202_203insG n/a
Download CSV