Transcript: Human NM_001266.5

Homo sapiens carboxylesterase 1 (CES1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CES1 (1066)
Length:
1940
CDS:
42..1742

Additional Resources:

NCBI RefSeq record:
NM_001266.5
NBCI Gene record:
CES1 (1066)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001266.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371769 ATGAGCTCTTCTCCGTCTTTG pLKO_005 1447 CDS 100% 10.800 5.400 Y CES1 n/a
2 TRCN0000371770 GAGCTCTTGGAGACGACATTG pLKO_005 918 CDS 100% 10.800 5.400 Y CES1 n/a
3 TRCN0000371771 TGAAACCCAAGACGGTGATAG pLKO_005 1414 CDS 100% 10.800 5.400 Y CES1 n/a
4 TRCN0000046936 CCTGCTGACTTGACCAAGAAA pLKO.1 411 CDS 100% 5.625 2.813 Y CES1 n/a
5 TRCN0000046935 TGCATTGCTAAGGAACTGATT pLKO.1 1206 CDS 100% 4.950 2.475 Y CES1 n/a
6 TRCN0000046933 CGGAATTAACAAGCAGGAGTT pLKO.1 1085 CDS 100% 4.050 2.025 Y CES1 n/a
7 TRCN0000046934 GAAATTCTTATCTCTGGACTT pLKO.1 944 CDS 100% 4.050 2.025 Y CES1 n/a
8 TRCN0000046937 CCAGACAGAACACATAGAGCT pLKO.1 1718 CDS 100% 2.640 1.320 Y CES1 n/a
9 TRCN0000047057 CACCGTGCATGGCAAAGTGTT pLKO.1 122 CDS 100% 4.950 2.970 N CES1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001266.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13829 pDONR223 100% 99.6% 99.2% None (many diffs) n/a
2 ccsbBroad304_13829 pLX_304 0% 99.6% 99.2% V5 (many diffs) n/a
3 TRCN0000476888 TTTCTTTGTTTGGAAACAGATCTG pLX_317 17.2% 99.6% 99.2% V5 (many diffs) n/a
4 ccsbBroadEn_12012 pDONR223 100% 24.8% 22.6% None (many diffs) n/a
5 ccsbBroad304_12012 pLX_304 0% 24.8% 22.6% V5 (many diffs) n/a
6 TRCN0000470717 ATGTACTCAGTATCCACCGTCGGT pLX_317 92.8% 24.8% 22.6% V5 (many diffs) n/a
Download CSV