Transcript: Human NM_001267050.2

Homo sapiens G protein-coupled receptor 155 (GPR155), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
GPR155 (151556)
Length:
7392
CDS:
235..2847

Additional Resources:

NCBI RefSeq record:
NM_001267050.2
NBCI Gene record:
GPR155 (151556)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356995 ACTCGGACTCCTGCGTGTATT pLKO_005 858 CDS 100% 13.200 18.480 N GPR155 n/a
2 TRCN0000356993 CTTAACCATTGCAGTCAATAT pLKO_005 261 CDS 100% 13.200 9.240 N GPR155 n/a
3 TRCN0000356994 GTCGGCATTTGTAGTACTAAT pLKO_005 1053 CDS 100% 13.200 9.240 N GPR155 n/a
4 TRCN0000008284 CCAGAATATCTCCAGTACATT pLKO.1 721 CDS 100% 5.625 3.938 N GPR155 n/a
5 TRCN0000008285 CCAGTAAATGAACCAGAACTT pLKO.1 1960 CDS 100% 4.950 3.465 N GPR155 n/a
6 TRCN0000008283 CCTGTCAACAATTTATCCATT pLKO.1 2483 CDS 100% 4.950 3.465 N GPR155 n/a
7 TRCN0000011425 GCATGGATTTAATTCCACTAA pLKO.1 309 CDS 100% 4.950 3.465 N GPR155 n/a
8 TRCN0000357033 TAACTTTGGTCAGGGATTTAT pLKO_005 2331 CDS 100% 15.000 9.000 N GPR155 n/a
9 TRCN0000008282 GCCTCAGTTGTCTCTTCTGTA pLKO.1 2950 3UTR 100% 4.950 2.970 N GPR155 n/a
10 TRCN0000166498 CGCCTGTAATCCCAGTACTTT pLKO.1 3209 3UTR 100% 5.625 2.813 Y MGC13053 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489127 TACAGCGATCATGGTAACCACTCC pLX_317 15.4% 99.9% 100% V5 2460C>T n/a
2 TRCN0000492114 GCATGGGCAACCACGCCCGGTAAA pLX_317 15.2% 99.9% 100% V5 (not translated due to prior stop codon) 2460C>T n/a
Download CSV