Transcript: Human NM_001267549.3

Homo sapiens ADP ribosylation factor related protein 1 (ARFRP1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
ARFRP1 (10139)
Length:
2589
CDS:
117..638

Additional Resources:

NCBI RefSeq record:
NM_001267549.3
NBCI Gene record:
ARFRP1 (10139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303688 ACGGCGTCATCTACGTCATTG pLKO_005 397 CDS 100% 10.800 15.120 N ARFRP1 n/a
2 TRCN0000047759 CCGATTTAACAAGAACTACAA pLKO.1 233 CDS 100% 4.950 6.930 N ARFRP1 n/a
3 TRCN0000310740 TGAGTCCAAGCAGGCGTTTGA pLKO_005 443 CDS 100% 4.950 6.930 N ARFRP1 n/a
4 TRCN0000380523 CACCACCGTGGGCCTAAACAT pLKO_005 278 CDS 100% 1.875 2.625 N ARFRP1 n/a
5 TRCN0000380613 GTCTTTGTGGGACAAGTATTA pLKO_005 365 CDS 100% 13.200 9.240 N ARFRP1 n/a
6 TRCN0000047761 CCTCTCAATCCCTGACATCAA pLKO.1 539 CDS 100% 4.950 3.465 N ARFRP1 n/a
7 TRCN0000310423 CCTCTCAATCCCTGACATCAA pLKO_005 539 CDS 100% 4.950 3.465 N ARFRP1 n/a
8 TRCN0000047758 CGAAGACAAACTTTCCTCTAT pLKO.1 925 3UTR 100% 4.950 3.465 N ARFRP1 n/a
9 TRCN0000299575 CGAAGACAAACTTTCCTCTAT pLKO_005 925 3UTR 100% 4.950 3.465 N ARFRP1 n/a
10 TRCN0000047762 CGGCTCATGTTCTGGGACTTA pLKO.1 324 CDS 100% 4.950 3.465 N ARFRP1 n/a
11 TRCN0000047760 GCAGTCTTTGTGGGACAAGTA pLKO.1 362 CDS 100% 4.950 3.465 N ARFRP1 n/a
12 TRCN0000379806 CAATGCTGGGAAGACGACCTT pLKO_005 194 CDS 100% 2.640 1.848 N ARFRP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07562 pDONR223 100% 85.9% 86% None 519_519delGins85 n/a
2 ccsbBroad304_07562 pLX_304 0% 85.9% 86% V5 (not translated due to frame shift) 519_519delGins85 n/a
3 TRCN0000476314 GAACCTTCATTTATCTTCGGGCAG pLX_317 46.5% 85.9% 86% V5 (not translated due to prior stop codon) 519_519delGins85 n/a
Download CSV