Transcript: Human NM_001270437.2

Homo sapiens CDC42 effector protein 3 (CDC42EP3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-19
Taxon:
Homo sapiens (human)
Gene:
CDC42EP3 (10602)
Length:
5038
CDS:
395..1159

Additional Resources:

NCBI RefSeq record:
NM_001270437.2
NBCI Gene record:
CDC42EP3 (10602)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048426 CACGATGTCTTTGGAGATATT pLKO.1 542 CDS 100% 13.200 18.480 N CDC42EP3 n/a
2 TRCN0000197889 GAAATTTAAACTGAGGGACAT pLKO.1 448 CDS 100% 4.050 5.670 N Cdc42ep3 n/a
3 TRCN0000426412 GGAACTTCACGGAACTTTATA pLKO_005 1498 3UTR 100% 15.000 10.500 N CDC42EP3 n/a
4 TRCN0000421284 GGTGATGTTCGGCTCACATAT pLKO_005 1402 3UTR 100% 13.200 9.240 N CDC42EP3 n/a
5 TRCN0000048424 GTGCTGAATGTAATGGATAAA pLKO.1 1130 CDS 100% 13.200 9.240 N CDC42EP3 n/a
6 TRCN0000416327 CTCATCAAGGGAAAGACTAAG pLKO_005 1031 CDS 100% 10.800 7.560 N CDC42EP3 n/a
7 TRCN0000048423 CCAGTGACATTTAATTCCAAA pLKO.1 767 CDS 100% 4.950 3.465 N CDC42EP3 n/a
8 TRCN0000048425 CCCTGGGCATAATGAGTTCTT pLKO.1 628 CDS 100% 4.950 3.465 N CDC42EP3 n/a
9 TRCN0000048427 CCTTATTGTCACCAGTGACAT pLKO.1 756 CDS 100% 0.495 0.347 N CDC42EP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02482 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02482 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471878 GTGTCGGGTTTGCTATCGAGTCCC pLX_317 60.9% 99.7% 99.6% V5 297_298delCTinsTC n/a
Download CSV