Transcript: Human NM_001270523.2

Homo sapiens orthodenticle homeobox 2 (OTX2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
OTX2 (5015)
Length:
2987
CDS:
288..1157

Additional Resources:

NCBI RefSeq record:
NM_001270523.2
NBCI Gene record:
OTX2 (5015)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015612 CCATGACCTATACTCAGGCTT pLKO.1 814 CDS 100% 2.640 3.696 N OTX2 n/a
2 TRCN0000176356 CCACTGATTGCTTGGATTATA pLKO.1 1045 CDS 100% 15.000 12.000 N Otx2 n/a
3 TRCN0000421657 GATCATTGGTTATCCTGATTT pLKO_005 1382 3UTR 100% 13.200 10.560 N OTX2 n/a
4 TRCN0000015611 GCTGGCTCAACTTCCTACTTT pLKO.1 855 CDS 100% 5.625 4.500 N OTX2 n/a
5 TRCN0000175734 GCTGACTGCTTGGATTATAAA pLKO.1 1101 CDS 100% 15.000 10.500 N Otx2 n/a
6 TRCN0000438502 AGGGTGCAGGTATGGTTTAAG pLKO_005 528 CDS 100% 13.200 9.240 N Otx2 n/a
7 TRCN0000015609 CCTCGTGGAAATTCCAGGTTT pLKO.1 1132 CDS 100% 4.950 3.465 N OTX2 n/a
8 TRCN0000015608 GCACTGAAACTTTACGACAAA pLKO.1 1921 3UTR 100% 4.950 3.465 N OTX2 n/a
9 TRCN0000419989 TAGCCAATCCTTGGTTGAATC pLKO_005 1531 3UTR 100% 10.800 6.480 N OTX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01128 pDONR223 100% 97.3% 97.3% None 96_97ins24 n/a
2 ccsbBroad304_01128 pLX_304 0% 97.3% 97.3% V5 96_97ins24 n/a
3 TRCN0000472658 TCCGCACGCTCGAAAAAACGTCGT pLX_317 51.2% 97.3% 97.3% V5 96_97ins24 n/a
Download CSV