Transcript: Human NM_001270927.2

Homo sapiens interferon induced protein with tetratricopeptide repeats 1 (IFIT1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
IFIT1 (3434)
Length:
4399
CDS:
188..1624

Additional Resources:

NCBI RefSeq record:
NM_001270927.2
NBCI Gene record:
IFIT1 (3434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159834 GACGATGAAATGCCTGATTTA pLKO.1 272 CDS 100% 13.200 18.480 N IFIT1 n/a
2 TRCN0000427724 TGATAAGATCAGCCATATTTC pLKO_005 1149 CDS 100% 13.200 18.480 N IFIT1 n/a
3 TRCN0000158439 CGTCAATGCAATTATCCATTA pLKO.1 1372 CDS 100% 10.800 15.120 N IFIT1 n/a
4 TRCN0000133636 GAGTTATCCATTGATGACGAT pLKO.1 257 CDS 100% 2.640 2.112 N IFIT1 n/a
5 TRCN0000159874 GCATCATTAACAAGGGATAAA pLKO.1 1418 CDS 100% 13.200 9.240 N IFIT1 n/a
6 TRCN0000412736 TTCACTGTAATGATGTAATTC pLKO_005 1719 3UTR 100% 13.200 9.240 N IFIT1 n/a
7 TRCN0000427895 CAGACCTATGTCTTTCGATAT pLKO_005 935 CDS 100% 10.800 7.560 N IFIT1 n/a
8 TRCN0000420067 CACTTTCACATTTCATTTCAT pLKO_005 1641 3UTR 100% 5.625 3.938 N IFIT1 n/a
9 TRCN0000162294 CTTCGGAGAAAGGCATTAGAT pLKO.1 1475 CDS 100% 5.625 3.938 N IFIT1 n/a
10 TRCN0000136563 CCAAGCAAATGTGAGGAGTCT pLKO.1 451 CDS 100% 2.640 1.848 N IFIT1 n/a
11 TRCN0000162770 CCCACTTCTGTCTTACTGCAT pLKO.1 1031 CDS 100% 2.640 1.848 N IFIT1 n/a
12 TRCN0000133852 GCTTAAATCCAGACAATGGAT pLKO.1 819 CDS 100% 0.300 0.210 N IFIT1 n/a
13 TRCN0000436002 ATATCAGCCACTTTCACATTT pLKO_005 1633 3UTR 100% 13.200 7.920 N IFIT1 n/a
14 TRCN0000158786 GTCACTTTACATGGGAGTTAT pLKO.1 243 CDS 100% 13.200 7.920 N IFIT1 n/a
15 TRCN0000419063 ATGAAGCCCTGGAGTACTATG pLKO_005 1548 CDS 100% 10.800 6.480 N IFIT1 n/a
16 TRCN0000162748 CACCAAATACAGTGTGGGAAT pLKO.1 328 CDS 100% 4.050 2.430 N IFIT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270927.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06426 pDONR223 100% 99.7% 99.7% None 4T>A;465A>G;525T>G n/a
2 ccsbBroad304_06426 pLX_304 0% 99.7% 99.7% V5 4T>A;465A>G;525T>G n/a
3 TRCN0000491593 GCTTCTTGCCTGACCTTGTTTTGA pLX_317 28.8% 99.7% 99.7% V5 4T>A;465A>G;525T>G n/a
Download CSV