Transcript: Mouse NM_001271511.1

Mus musculus DNA segment, Chr 17, Wayne State University 92, expressed (D17Wsu92e), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
D17Wsu92e (224647)
Length:
3483
CDS:
209..925

Additional Resources:

NCBI RefSeq record:
NM_001271511.1
NBCI Gene record:
D17Wsu92e (224647)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252561 GCAGCGATTGGCGCCTATTAT pLKO_005 377 CDS 100% 15.000 21.000 N D17Wsu92e n/a
2 TRCN0000425743 TTAAACGGGTGTCAGCAAGAA pLKO_005 752 CDS 100% 4.950 6.930 N ILRUN n/a
3 TRCN0000252562 CCCTGATACCCAGTTCATAAA pLKO_005 478 CDS 100% 13.200 10.560 N D17Wsu92e n/a
4 TRCN0000252559 CCTGTATGGACTGGCTATAAC pLKO_005 3152 3UTR 100% 13.200 9.240 N D17Wsu92e n/a
5 TRCN0000252563 CTGCTACTGGACTCTACTATG pLKO_005 696 CDS 100% 10.800 7.560 N D17Wsu92e n/a
6 TRCN0000144085 CTTTGTTGAAGATGTCACCAT pLKO.1 436 CDS 100% 2.640 1.848 N ILRUN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271511.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03964 pDONR223 100% 65.3% 58.1% None (many diffs) n/a
2 ccsbBroad304_03964 pLX_304 0% 65.3% 58.1% V5 (many diffs) n/a
3 TRCN0000467794 CTGACCCCTTCAGTACCCGCCGCT pLX_317 43.5% 65.3% 58.1% V5 (many diffs) n/a
Download CSV