Transcript: Human NM_001271763.2

Homo sapiens dihydrouridine synthase 2 (DUS2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
DUS2 (54920)
Length:
1877
CDS:
167..1543

Additional Resources:

NCBI RefSeq record:
NM_001271763.2
NBCI Gene record:
DUS2 (54920)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271763.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294010 CAGATGCCGTTGAACAGTTTG pLKO_005 1615 3UTR 100% 10.800 15.120 N DUS2 n/a
2 TRCN0000064788 CCTGTGTATGAAACGGTTCAA pLKO.1 1217 CDS 100% 4.950 6.930 N DUS2 n/a
3 TRCN0000286654 CCTGTGTATGAAACGGTTCAA pLKO_005 1217 CDS 100% 4.950 6.930 N DUS2 n/a
4 TRCN0000064790 CGGGAAATTTGTGAGGCCTTT pLKO.1 983 CDS 100% 4.050 5.670 N DUS2 n/a
5 TRCN0000293976 ATGACCACATCCAACAGTATT pLKO_005 714 CDS 100% 13.200 10.560 N DUS2 n/a
6 TRCN0000294011 GATCCTCAGCACTCTTGTTAA pLKO_005 478 CDS 100% 13.200 9.240 N DUS2 n/a
7 TRCN0000064791 TCAGTGCAAGAGAGTTGTTAA pLKO.1 316 CDS 100% 13.200 9.240 N DUS2 n/a
8 TRCN0000252092 TGGATTATGGAGCGGACATTG pLKO_005 261 CDS 100% 10.800 7.560 N Dus2 n/a
9 TRCN0000064789 CCTTGGGAAGTGGTGAAGAAA pLKO.1 1503 CDS 100% 5.625 3.938 N DUS2 n/a
10 TRCN0000064792 CCACTACACCAACACCAAGTA pLKO.1 889 CDS 100% 4.950 2.970 N DUS2 n/a
11 TRCN0000286590 CCACTACACCAACACCAAGTA pLKO_005 889 CDS 100% 4.950 2.970 N DUS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271763.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03481 pDONR223 100% 92.9% 92.9% None 263_264ins105 n/a
2 ccsbBroad304_03481 pLX_304 0% 92.9% 92.9% V5 263_264ins105 n/a
3 TRCN0000471503 TTTCTGAACCGCCCTTAATAACAA pLX_317 35.7% 92.9% 92.9% V5 263_264ins105 n/a
Download CSV