Transcript: Human NM_001271783.2

Homo sapiens fatty acyl-CoA reductase 2 (FAR2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
FAR2 (55711)
Length:
3538
CDS:
169..1716

Additional Resources:

NCBI RefSeq record:
NM_001271783.2
NBCI Gene record:
FAR2 (55711)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123279 CCTTGCGTATTAAACGTGAAA pLKO.1 1966 3UTR 100% 4.950 6.930 N FAR2 n/a
2 TRCN0000123280 CCTCTTTAATACTGCCCTCTT pLKO.1 1572 CDS 100% 4.050 3.240 N FAR2 n/a
3 TRCN0000123281 CATGAGAAGATCAGAGCTATT pLKO.1 394 CDS 100% 10.800 7.560 N FAR2 n/a
4 TRCN0000123282 CCACATTACATCTGGTAACAT pLKO.1 1077 CDS 100% 5.625 3.938 N FAR2 n/a
5 TRCN0000123283 CGATGCTATTATTGACGAGAT pLKO.1 723 CDS 100% 4.050 2.835 N FAR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03636 pDONR223 100% 99.9% 100% None 78G>A n/a
2 ccsbBroad304_03636 pLX_304 0% 99.9% 100% V5 78G>A n/a
3 TRCN0000480027 TGGCAGCCGGTCCTCCTTCGACCC pLX_317 25.6% 99.9% 100% V5 78G>A n/a
Download CSV