Transcript: Human NM_001271785.2

Homo sapiens dynein cytoplasmic 1 intermediate chain 2 (DYNC1I2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-12
Taxon:
Homo sapiens (human)
Gene:
DYNC1I2 (1781)
Length:
4314
CDS:
129..2045

Additional Resources:

NCBI RefSeq record:
NM_001271785.2
NBCI Gene record:
DYNC1I2 (1781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296603 TTTGGGACGAGGACCTATTAA pLKO_005 518 CDS 100% 15.000 21.000 N DYNC1I2 n/a
2 TRCN0000116799 GCAGGTGCTAAACTGTCATTA pLKO.1 909 CDS 100% 13.200 18.480 N DYNC1I2 n/a
3 TRCN0000290170 GCAGGTGCTAAACTGTCATTA pLKO_005 909 CDS 100% 13.200 18.480 N DYNC1I2 n/a
4 TRCN0000349910 AGCATGGAGTTGGTTCATAAA pLKO_005 1389 CDS 100% 13.200 9.240 N Dync1i2 n/a
5 TRCN0000116801 GTGGCTCCTAAACCACCTATT pLKO.1 663 CDS 100% 10.800 7.560 N DYNC1I2 n/a
6 TRCN0000296596 TCTTCAGCTTCACTCAGATTC pLKO_005 494 CDS 100% 10.800 7.560 N DYNC1I2 n/a
7 TRCN0000116797 CCCTGTTATACAGATAATGTT pLKO.1 2407 3UTR 100% 5.625 3.938 N DYNC1I2 n/a
8 TRCN0000290169 CCCTGTTATACAGATAATGTT pLKO_005 2407 3UTR 100% 5.625 3.938 N DYNC1I2 n/a
9 TRCN0000116800 GCAGACTATGTTTATGATGTT pLKO.1 1698 CDS 100% 4.950 3.465 N DYNC1I2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10787 pDONR223 100% 95.9% 95.9% None 226_243del;335_394del n/a
2 ccsbBroad304_10787 pLX_304 0% 95.9% 95.9% V5 226_243del;335_394del n/a
3 TRCN0000474323 ATACGTCGTAATTGCCCCCTCTAT pLX_317 26.4% 95.9% 95.9% V5 226_243del;335_394del n/a
Download CSV