Transcript: Human NM_001271842.1

Homo sapiens SLP adaptor and CSK interacting membrane protein (SCIMP), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
SCIMP (388325)
Length:
2403
CDS:
106..522

Additional Resources:

NCBI RefSeq record:
NM_001271842.1
NBCI Gene record:
SCIMP (388325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163618 CGCTACATACTCACTGGTAAA pLKO.1 396 CDS 100% 10.800 15.120 N SCIMP n/a
2 TRCN0000163297 GTTCTTAATGAGTCGCCAGTT pLKO.1 298 CDS 100% 4.050 5.670 N SCIMP n/a
3 TRCN0000160339 CAATCAAGAATGGTTGAACTT pLKO.1 581 3UTR 100% 4.950 3.960 N SCIMP n/a
4 TRCN0000161436 GATGTTGAAATCCCTGCAAAT pLKO.1 481 CDS 100% 10.800 7.560 N SCIMP n/a
5 TRCN0000164634 CTTGTGCTGTTGAGGAAACTT pLKO.1 759 3UTR 100% 5.625 3.938 N SCIMP n/a
6 TRCN0000161862 GATGACTATGACGATGTTGAA pLKO.1 469 CDS 100% 4.950 3.465 N SCIMP n/a
7 TRCN0000164322 CGATGTTGAAATCCCTGCAAA pLKO.1 480 CDS 100% 4.950 2.970 N SCIMP n/a
8 TRCN0000161198 GAAGATGACTATGACGATGTT pLKO.1 466 CDS 100% 4.950 2.970 N SCIMP n/a
9 TRCN0000162962 GCTGTTGAGGAAACTTTCCAT pLKO.1 764 3UTR 100% 3.000 1.800 N SCIMP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271842.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05576 pDONR223 100% 95.1% 95.1% None 124_125ins21 n/a
2 ccsbBroad304_05576 pLX_304 0% 95.1% 95.1% V5 124_125ins21 n/a
3 TRCN0000477444 TGCGAATTTTACATGTCCAAGCAA pLX_317 98.6% 95.1% 95.1% V5 124_125ins21 n/a
4 ccsbBroadEn_10092 pDONR223 100% 94.9% 95.1% None 124_125ins21;279A>G n/a
5 TRCN0000475762 TTCATCTACACAGTTCCCTTGTCC pLX_317 59.8% 94.9% 95.1% V5 124_125ins21;279A>G n/a
6 ccsbBroadEn_16164 pDONR223 0% 94.7% 95.1% None 84C>T;99T>C;124_125ins21 n/a
7 ccsbBroad304_16164 pLX_304 0% 94.7% 95.1% V5 84C>T;99T>C;124_125ins21 n/a
8 TRCN0000477298 CGAGCATGCTTGTTAGAGTCCTGT pLX_317 98.6% 94.7% 95.1% V5 84C>T;99T>C;124_125ins21 n/a
Download CSV