Transcript: Mouse NM_001271962.1

Mus musculus EYA transcriptional coactivator and phosphatase 2 (Eya2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Eya2 (14049)
Length:
2283
CDS:
72..1670

Additional Resources:

NCBI RefSeq record:
NM_001271962.1
NBCI Gene record:
Eya2 (14049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029852 CGGAGACTACAACACACACAA pLKO.1 713 CDS 100% 4.950 3.960 N Eya2 n/a
2 TRCN0000029850 CCAGTATTTCAGCCCATCATA pLKO.1 578 CDS 100% 5.625 3.938 N Eya2 n/a
3 TRCN0000029851 CCCTGGAACTGGAGTATCTAT pLKO.1 1648 CDS 100% 5.625 3.938 N Eya2 n/a
4 TRCN0000029849 CCATTTCAGAAGTGTCTTCTT pLKO.1 1792 3UTR 100% 4.950 3.465 N Eya2 n/a
5 TRCN0000029853 CGAAAGAATCATGCAGAGGTT pLKO.1 1505 CDS 100% 2.640 1.848 N Eya2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10814 pDONR223 100% 79.1% 83.8% None (many diffs) n/a
2 ccsbBroad304_10814 pLX_304 0% 79.1% 83.8% V5 (many diffs) n/a
3 TRCN0000480873 GTAATCCGAGGTCCCTTCATGGCA pLX_317 24.8% 79.1% 83.8% V5 (many diffs) n/a
4 TRCN0000491450 TTGCACAGCAGGTGCTAGAGGTTA pLX_317 20.9% 79.1% 83.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491747 CCGATGCCTCCCGTACTACGTGCC pLX_317 22.8% 79.1% 83.8% V5 (many diffs) n/a
Download CSV