Transcript: Human NM_001276.4

Homo sapiens chitinase 3 like 1 (CHI3L1), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
CHI3L1 (1116)
Length:
1747
CDS:
82..1233

Additional Resources:

NCBI RefSeq record:
NM_001276.4
NBCI Gene record:
CHI3L1 (1116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001276.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371785 ATCAAGTCAGTACCGCCATTT pLKO_005 439 CDS 100% 10.800 15.120 N CHI3L1 n/a
2 TRCN0000371784 TAGCATCATGACCTACGATTT pLKO_005 684 CDS 100% 10.800 15.120 N CHI3L1 n/a
3 TRCN0000051955 CAATATAAGCAACGATCACAT pLKO.1 258 CDS 100% 4.950 6.930 N CHI3L1 n/a
4 TRCN0000051956 GATGGAACTTTGGGTCTCAAA pLKO.1 374 CDS 100% 4.950 3.465 N CHI3L1 n/a
5 TRCN0000051954 CCTGACAGATTCAGCAACACT pLKO.1 772 CDS 100% 3.000 2.100 N CHI3L1 n/a
6 TRCN0000051957 GCTCCAGTGCTGCTCTGCATA pLKO.1 126 CDS 100% 1.650 1.155 N CHI3L1 n/a
7 TRCN0000051953 CAAGGAAATGAAGGCCGAATT pLKO.1 543 CDS 100% 0.000 0.000 N CHI3L1 n/a
8 TRCN0000371740 CCTTATCAAAGGACACCATTT pLKO_005 1552 3UTR 100% 10.800 6.480 N CHI3L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05992 pDONR223 100% 99.8% 99.7% None 433A>G;1092T>C n/a
2 ccsbBroad304_05992 pLX_304 0% 99.8% 99.7% V5 433A>G;1092T>C n/a
3 TRCN0000475176 CTTGGATCGTACGGACGAATAATT pLX_317 32.5% 99.8% 99.7% V5 433A>G;1092T>C n/a
4 ccsbBroadEn_05991 pDONR223 100% 99.8% 99.7% None 16T>G;1092T>C n/a
5 ccsbBroad304_05991 pLX_304 0% 99.8% 99.7% V5 16T>G;1092T>C n/a
Download CSV