Transcript: Human NM_001276293.2

Homo sapiens nischarin (NISCH), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NISCH (11188)
Length:
3181
CDS:
39..1790

Additional Resources:

NCBI RefSeq record:
NM_001276293.2
NBCI Gene record:
NISCH (11188)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001276293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256841 TGCCGTTCGACCTATCAATAT pLKO_005 664 CDS 100% 13.200 18.480 N NISCH n/a
2 TRCN0000256842 CTGTCGCCTTAAGTACCTTAA pLKO_005 590 CDS 100% 10.800 15.120 N NISCH n/a
3 TRCN0000583926 CTGAAGGCACAACCCTAGAAG pLKO_005 847 CDS 100% 4.950 6.930 N NISCH n/a
4 TRCN0000161240 GTGGAGATAAGTCACTGTGAT pLKO.1 702 CDS 100% 4.950 3.465 N NISCH n/a
5 TRCN0000162883 GCACCTGTATAACCTTGTGCA pLKO.1 1025 CDS 100% 2.640 1.848 N NISCH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07768 pDONR223 100% 36.8% 34.4% None (many diffs) n/a
2 ccsbBroad304_07768 pLX_304 0% 36.8% 34.4% V5 (many diffs) n/a
3 TRCN0000476629 CCAAAACAGGGGTCACAGGAATCA pLX_317 8.3% 36.8% 34.4% V5 (many diffs) n/a
Download CSV