Transcript: Mouse NM_001276358.1

Mus musculus Kv channel-interacting protein 2 (Kcnip2), transcript variant d, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Kcnip2 (80906)
Length:
2025
CDS:
7..684

Additional Resources:

NCBI RefSeq record:
NM_001276358.1
NBCI Gene record:
Kcnip2 (80906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001276358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069759 GCTGGTTTGTCAGTGATTCTT pLKO.1 370 CDS 100% 5.625 4.500 N Kcnip2 n/a
2 TRCN0000069758 CGAGGAGAACTTCAAGCAAAT pLKO.1 243 CDS 100% 10.800 7.560 N Kcnip2 n/a
3 TRCN0000069762 CGACATCATGAAGTCCATCTA pLKO.1 477 CDS 100% 4.950 3.465 N Kcnip2 n/a
4 TRCN0000069761 GCCTTTGACACCAACCATGAT pLKO.1 322 CDS 100% 4.950 3.465 N Kcnip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03136 pDONR223 100% 76.6% 74.6% None (many diffs) n/a
2 ccsbBroad304_03136 pLX_304 0% 76.6% 74.6% V5 (many diffs) n/a
3 TRCN0000472305 TCCACACCAAATTTCAATAGGCGC pLX_317 63.9% 76.6% 74.6% V5 (many diffs) n/a
Download CSV