Transcript: Human NM_001276727.1

Homo sapiens chromosome 11 open reading frame 74 (C11orf74), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
C11orf74 (119710)
Length:
689
CDS:
124..567

Additional Resources:

NCBI RefSeq record:
NM_001276727.1
NBCI Gene record:
C11orf74 (119710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001276727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130065 GAACATCAAAGAGCTATGCAA pLKO.1 495 CDS 100% 3.000 2.100 N C11orf74 n/a
2 TRCN0000148202 GAAGAGATACTTGGAGATGAA pLKO.1 394 CDS 100% 4.950 2.970 N C11orf74 n/a
3 TRCN0000147798 GCAGAGATAGAGAACATCAAA pLKO.1 484 CDS 100% 5.625 2.813 Y C11orf74 n/a
4 TRCN0000127957 CACCAGCATTCCTTCCTGTAT pLKO.1 300 CDS 100% 4.950 2.475 Y C11orf74 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13077 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13077 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468226 ACAGACGCTGATGGCCGGTAATTG pLX_317 84.5% 100% 100% V5 n/a
4 ccsbBroadEn_04740 pDONR223 100% 66.5% 66.5% None 135_136ins222 n/a
5 ccsbBroad304_04740 pLX_304 0% 66.5% 66.5% V5 135_136ins222 n/a
6 TRCN0000469896 CAATCAGTGCGTCATCAAGGATAC pLX_317 70.1% 66.5% 66.5% V5 135_136ins222 n/a
Download CSV