Transcript: Mouse NM_001277113.1

Mus musculus ribosomal protein L22 (Rpl22), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rpl22 (19934)
Length:
2153
CDS:
40..495

Additional Resources:

NCBI RefSeq record:
NM_001277113.1
NBCI Gene record:
Rpl22 (19934)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001277113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104278 CGTGACCATCGAACGCAGCAA pLKO.1 288 CDS 100% 0.880 1.232 N Rpl22 n/a
2 TRCN0000104275 CGCTCACAGTTGTGTGTACTA pLKO.1 953 3UTR 100% 4.950 3.960 N Rpl22 n/a
3 TRCN0000376973 GGGACAATGACAGTCAGTAAG pLKO_005 891 3UTR 100% 10.800 7.560 N Rpl22 n/a
4 TRCN0000075014 CCCTGTAGAAGATGGAATCAT pLKO.1 189 CDS 100% 5.625 3.938 N RPL22 n/a
5 TRCN0000291967 CCCTGTAGAAGATGGAATCAT pLKO_005 189 CDS 100% 5.625 3.938 N RPL22 n/a
6 TRCN0000376893 GAGCTGGTGGTTGGTTATATC pLKO_005 780 3UTR 100% 13.200 7.920 N Rpl22 n/a
7 TRCN0000104276 GCTGCGTTACTTCCAGATTAA pLKO.1 441 CDS 100% 13.200 7.920 N Rpl22 n/a
8 TRCN0000323913 GCTGCGTTACTTCCAGATTAA pLKO_005 441 CDS 100% 13.200 7.920 N Rpl22 n/a
9 TRCN0000104279 CGCCAACAGCAAAGAGAGTTA pLKO.1 417 CDS 100% 4.950 2.475 Y Rpl22 n/a
10 TRCN0000353825 CGCCAACAGCAAAGAGAGTTA pLKO_005 417 CDS 100% 4.950 2.475 Y Rpl22 n/a
11 TRCN0000104277 CCAGGAGAGAATCAAGGTGAA pLKO.1 237 CDS 100% 4.050 2.025 Y Rpl22 n/a
12 TRCN0000323841 CCAGGAGAGAATCAAGGTGAA pLKO_005 237 CDS 100% 4.050 2.025 Y Rpl22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01425 pDONR223 100% 74.6% 81.4% None (many diffs) n/a
2 ccsbBroad304_01425 pLX_304 0% 74.6% 81.4% V5 (many diffs) n/a
3 TRCN0000480543 GGCCCTCGGACTTACATGTGGACA pLX_317 96.5% 74.6% 81.4% V5 (many diffs) n/a
Download CSV