Transcript: Human NM_001277129.1

Homo sapiens NLR family pyrin domain containing 12 (NLRP12), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
NLRP12 (91662)
Length:
3709
CDS:
230..3244

Additional Resources:

NCBI RefSeq record:
NM_001277129.1
NBCI Gene record:
NLRP12 (91662)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277129.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107108 CGACCTTTACCTGACCAACAA pLKO.1 3061 CDS 100% 4.950 6.930 N NLRP12 n/a
2 TRCN0000107106 GCTCTCATAGCCAATAAGAAT pLKO.1 2522 CDS 100% 5.625 3.938 N NLRP12 n/a
3 TRCN0000107109 GAAGGAATACTTCTACAAGTA pLKO.1 1339 CDS 100% 0.495 0.347 N NLRP12 n/a
4 TRCN0000107107 CCACTTGAGTTTCCAGGAATT pLKO.1 1768 CDS 100% 0.000 0.000 N NLRP12 n/a
5 TRCN0000107105 CGAGGTCAGGAGTTTGAGATT pLKO.1 3472 3UTR 100% 4.950 2.475 Y NLRP12 n/a
6 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3595 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277129.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09321 pDONR223 100% 94.5% 94.6% None 2394A>G;2755_2756ins171 n/a
2 ccsbBroad304_09321 pLX_304 0% 94.5% 94.6% V5 2394A>G;2755_2756ins171 n/a
Download CSV