Transcript: Human NM_001277199.2

Homo sapiens cornichon family AMPA receptor auxiliary protein 4 (CNIH4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
CNIH4 (29097)
Length:
4374
CDS:
514..744

Additional Resources:

NCBI RefSeq record:
NM_001277199.2
NBCI Gene record:
CNIH4 (29097)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277199.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184650 GAGGAGCCAGAGACTTCTTAA pLKO.1 793 3UTR 100% 13.200 9.240 N CNIH4 n/a
2 TRCN0000183590 GATCCAACAGAAATACACAAT pLKO.1 613 CDS 100% 4.950 3.465 N CNIH4 n/a
3 TRCN0000339012 GATCCAACAGAAATACACAAT pLKO_005 613 CDS 100% 4.950 3.465 N CNIH4 n/a
4 TRCN0000149322 GTCACACATGAAAGAAGCCAT pLKO.1 648 CDS 100% 2.640 1.848 N CNIH4 n/a
5 TRCN0000339013 GTCACACATGAAAGAAGCCAT pLKO_005 648 CDS 100% 2.640 1.848 N CNIH4 n/a
6 TRCN0000129451 GAGTGGTAACATGGGAGTGTT pLKO.1 591 CDS 100% 4.950 2.970 N CNIH4 n/a
7 TRCN0000339011 GAGTGGTAACATGGGAGTGTT pLKO_005 591 CDS 100% 4.950 2.970 N CNIH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277199.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08111 pDONR223 100% 54.6% 54.6% None 0_1ins189 n/a
2 ccsbBroad304_08111 pLX_304 0% 54.6% 54.6% V5 0_1ins189 n/a
3 TRCN0000471048 TCACCACTGCGTTAATACACGGCA pLX_317 83.9% 54.6% 54.6% V5 0_1ins189 n/a
Download CSV