Transcript: Mouse NM_001277954.1

Mus musculus SH3-domain GRB2-like 3 (Sh3gl3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Sh3gl3 (20408)
Length:
1641
CDS:
380..1216

Additional Resources:

NCBI RefSeq record:
NM_001277954.1
NBCI Gene record:
Sh3gl3 (20408)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001277954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093438 GCGAATATCTCTTGCATCCAA pLKO.1 898 CDS 100% 3.000 4.200 N Sh3gl3 n/a
2 TRCN0000334823 GCGAATATCTCTTGCATCCAA pLKO_005 898 CDS 100% 3.000 4.200 N Sh3gl3 n/a
3 TRCN0000093437 CTGTTGCAGAAATCCTTTCAA pLKO.1 316 5UTR 100% 5.625 3.938 N Sh3gl3 n/a
4 TRCN0000334905 CTGTTGCAGAAATCCTTTCAA pLKO_005 316 5UTR 100% 5.625 3.938 N Sh3gl3 n/a
5 TRCN0000093435 CCAGTAAAGCTGTTGCAGAAA pLKO.1 307 5UTR 100% 4.950 3.465 N Sh3gl3 n/a
6 TRCN0000334904 CCAGTAAAGCTGTTGCAGAAA pLKO_005 307 5UTR 100% 4.950 3.465 N Sh3gl3 n/a
7 TRCN0000093436 CCCGAGGAAGAAATCAGACAA pLKO.1 707 CDS 100% 4.950 3.465 N Sh3gl3 n/a
8 TRCN0000093434 GATTTCTTTGTCCTAACTCAT pLKO.1 1375 3UTR 100% 4.950 3.465 N Sh3gl3 n/a
9 TRCN0000334824 GATTTCTTTGTCCTAACTCAT pLKO_005 1375 3UTR 100% 4.950 3.465 N Sh3gl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11130 pDONR223 100% 53.4% 51.5% None (many diffs) n/a
2 ccsbBroad304_11130 pLX_304 0% 53.4% 51.5% V5 (many diffs) n/a
3 TRCN0000470237 AACTTCTATATCTTTAAACCTCTC pLX_317 44.2% 53.4% 51.5% V5 (many diffs) n/a
Download CSV