Transcript: Human NM_001278173.1

Homo sapiens zinc finger protein 33A (ZNF33A), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
ZNF33A (7581)
Length:
6209
CDS:
204..2693

Additional Resources:

NCBI RefSeq record:
NM_001278173.1
NBCI Gene record:
ZNF33A (7581)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014949 CGTGTGACTTCGCACCTTAAA pLKO.1 1608 CDS 100% 13.200 18.480 N ZNF33A n/a
2 TRCN0000014948 CGGGCATAACACCTTACAGAT pLKO.1 2817 3UTR 100% 4.950 6.930 N ZNF33A n/a
3 TRCN0000428569 CGTCAAGGGACAATCACTATG pLKO_005 1063 CDS 100% 10.800 8.640 N ZNF33A n/a
4 TRCN0000424378 ACCATTTAATGTGGATGTAAG pLKO_005 629 CDS 100% 10.800 7.560 N ZNF33A n/a
5 TRCN0000418793 AGTCATCATGAGGAGACTTTG pLKO_005 858 CDS 100% 10.800 7.560 N ZNF33A n/a
6 TRCN0000014950 TCAGTGTGATTCATGTGGAAT pLKO.1 677 CDS 100% 4.950 3.465 N ZNF33A n/a
7 TRCN0000428075 CAAACTTCCTCTAAGGATAAT pLKO_005 3130 3UTR 100% 13.200 7.920 N ZNF33A n/a
8 TRCN0000014951 GCCAGAAATCTGACCTCACTA pLKO.1 1525 CDS 100% 4.950 2.970 N ZNF33A n/a
9 TRCN0000014657 CCCTCTCTCAACATTATAGAA pLKO.1 1957 CDS 100% 5.625 2.813 Y ZNF33B n/a
10 TRCN0000014656 CCCTCACATTACACCAGAGAA pLKO.1 1453 CDS 100% 4.950 2.475 Y ZNF33B n/a
11 TRCN0000014952 CCTCCATAATGCCTCAGAGTA pLKO.1 2627 CDS 100% 4.950 2.475 Y ZNF33A n/a
12 TRCN0000164885 GCTGAGGCAGAAGAATCACTT pLKO.1 4802 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4638 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11231 pDONR223 100% 97.8% 97.4% None 1_36del;41delC;45_61del n/a
2 ccsbBroad304_11231 pLX_304 0% 97.8% 97.4% V5 1_36del;41delC;45_61del n/a
3 TRCN0000478493 CGGCATATTGCGATGCGTGTTATC pLX_317 13.3% 97.8% 97.4% V5 1_36del;41delC;45_61del n/a
Download CSV